Description :
From Genome Similarity Track
Location :
Scaffold_2307:2899- 5371
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_2307-abinit-gene-0.4ENSANGP00000018727

Sequence
2472 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGACGCGAGCGCCGGCAGCACGTGCGCGCGCCAGAGGCTCCGCAGCCGCGCAGGCGACAG
CGCGGACGCTGCTGCTGCTGGTGAGGAGGAGGGCAGCGGGCTCTTGCGCAGCATGTGGCAGCAGTGCTTGATGAGCTCCTCGTTTTTCTGTTTCTGAAAA
AAAGTGTTTGTTCGTGCTGTTTGGTCGGAGCCGACCGCGTATTTTTAGCCCGACCTTCTTCTCGAGGTCCTTTTCTGTAATTTTGTGTTTTGGACACACA
TAAAATGCTCATATATTGTAATTGAAACGAACAACTGCGAGTGATTTGTTGAATATAATATTTAAAGTGGCTATATCCTCGAATATCTAGAATGGATGCG
ATTGTTCTGTTGGGTTCTTTTTTTTCCGGATAAGAGTCAAGTTGGCTCTATAATCCTGTTCAAAAGCACTTATAAAGACACGGAAAACCAGAGCCGACTC
TCGCCCGACTTGATTGCATGAGCTTGGCAAATAGGACACCAAGCCTCAGACGAACCTTTCGACCCACGAACCCTATTCAGGGTTACTACAGGGTTCATCG
AAAACAGGGTAAACAAGATACCGTTTTTCCAGGTTAATCAGGTAAAAAGGATACCGCTTTTCCAGGTTAATCAGGTTCGTGCTGTAATAAAGGGCAAAAA
TAATTACAAAATCGAGGGTTCGGTGAACTCAGTCTCATTCCGGATAATATTATGCATTATCCGGATGCGCGTAAGAACATTTTCCACACATTTTATTAGA
TGAATTACGGGGCAATTACTAATTGGTCACTGATTTTGAGGAAAGCTTATCAATTAGTCACTAAGACAATTTCAGGTTACTAAACCGTTGCTGCCTCAAA
AATCAAGCCAGAAAAGAAAGTAAGAATACTAATTGGTTACCAAAAAGGAGCAGAAAACTACTAATTGGTTACCAGATGACTTTGAAAAATTCATGGCAAG
ATTGGCAAGTCCGCAACTGTCTAAAATAAACTGAAGGATGATAGCAGGCATTCATTACCAAATACGATGAGCGACACACGGAAGGGTGCCACGTTTGCCT
GCGAGAAATGCAACAAGCATATTTCCATCAAGAACAAAGATTGCCATCTCGAGTCGTCACTTTACGGCAACAGTGCTCTTGGGCTGGAGTACCTGTTGGC
GCAGCGTGAGAAAAGAGACAGCACGACTGCAAGTACCAGCGTAGACGCCGCGCGCATCAAAGCGAGCAACGTGAGGGCCATTTGCTTCAACCTCTCCGCG
ACCATGAGCCGAGTGTTCCACAGGATGTTACGGGCACACCTGCACTCGAGCAGCCTCGTATCGATGAATCCTCGACGACCACTCCGCTCGAGCAGCCGGC
CGTCGACGAAGCCACCACGACAAATCTATTTGCCATCGAGGTCAACGAGGAAGCTGTGGAAGAAGAGAATATGTGCGCGATATGCCAATTTCCTTTTACA
AACCCTCTTAGGTCGATTAATTGTGTCGACTACTTTTGTCAGGAATGCATCGATGAGCAACTGGCACGTACCATACAATGCAGTAGTCGCCGGCGGACAT
TTCTTTGCCCTTTGTGTCGGGTGCCAATGATATTTCTCTAAATGTATAATTGAATAAATTTTGACAATTTTGGGTTACCCTGATGAATTACAGATTATTC
CCATTTTCTGAGCCAATCGCGATAAAGCCTGTATTTTGACATATCAAATGGTCAAACCAGGAACCTGCACACGCTGTGTAGTAGGAATGCATGTAGTTTA
TCGACGAAGGGGTGGGACACGAAACGCTCACGAACCTGGTTTATGCCCAAGATCTGTGTGATGATGTGGATGCACTTTTCGCACTTCCAGTACGCGTGGG
AACAGGTCCGGACTGTAGTAATCGATTCTGGGACCTCCAGAGTTCAAGCCAAGGGGTGGGGCTCTCTCAAGAAGTCCAGGATATTGGCAATATCTCACAC
TGTGCACCCTTTAGTTCTTTTGATCTAAGTAATACCCGAACAATGCCCGGACACAACTAGAATTTCCAGACTATTAGGAAATACACCACACACACGCAAT
TCACACTGCACTTCGCTCAACGATCTTTTTGTTTTTCGGTGTAGATTCAACACCTTTCAGGCAAAACTGGTTCGGCCGAAGTGTCGCCATACACAACCCG
GGCGTCACGTCAATTCCAAGATTCCTGAGGGATCTGGAGGACAGTTGGTCAATTGAGGGGTTTATCTCAAGA