Description :
From Genome Similarity Track
Location :
Scaffold_58:28988- 31103
Transcript NameFunction/comments
Phyca_LT1534530171myosin-like protein

Sequence
2115 bases(100 bases per row)
aatgctacgtgcctgacgagaggtacgtgtggctgccagcgcagatcctgcgcgaggacaagagctcggaccctaagaagcctgagaagacgatcgtgct
gcgtgtattccctcctcctggtgatgcctccgctgttgtggacgaggaacgcgtactggactttaatgatcccaaggtcaaggctttactcaagagtctg
caactcgagtctctgccctatcagaacgacaacctggggcctgagggcatcgaagacatgacagcgctcaattatcttcacgaggcagcgatcctgtaca
acgtcaaaacgagattcctgcagaagctcccgtatacgtacacaggagatatctgtatagctgtcaacccataccagtggctaccggagctgtattcgga
gcgggcacagagtgaatatcttaccaaggctaaggaggaactgccacctcatgtttacgcgacgtctatggcatcgtacaacgatatgaagcgccatgaa
gtcaaccaatccattctggttagtggggagtcgggagctggaaaaacggagaccacaaagatcctcatgaaccacttggcttccatcgctggcggtctga
atgactacactattaagaagatcattgaggtgaatcctctactggagtcgttcggtaacgctaagacggtgaggaacgacaactcaagtcgatttggcaa
gttcacgcagttgcagtttgacaatgcaggaattttggttggagcccggtgcagaacctacttgttggaaaagacccgagtaatttcccatgaagacgcg
gaaaggaactaccacatcttttaccagttgctagcagccagtgacagcaaggaaaaatggttcttggatgactccaacgagtgctattcgtacactggtg
cgaacaagacgattaagattgagggcatgtctgatgataagcactttgaacgcacgaaaacggcgctaggacttattggtgtgacggaggagcaacaggg
ggctctctttgaagtgttagcaggcgtattacacctcggacaagtggagcttcaggcaaaaataataatgaggagtcagaattgatgcctgacgatcaag
gtgcgaagaatgcgaccaaactcttaggtatctcgacagaagatctggaaaaagccctctgtacacggcaaattgcagtcgccggtgataaggtgactac
ctttttgaagaaagacaaggctgaggaatgtgtgggtgctttatcaaaggctatatactcgaacgtgttcgactggctggtcgagatgatcaattcgtcc
ctgcaaaatgacaaaaaaatgcgacatcatgtgggtatcctcgatatctttggcttcgagcactttaaacataactcattcgaacagttttgcatcaact
acgcaaacgagaagcttcagcagaaattcacgcaggatgtcttcaagaccgtgcaaattgagtacgaagctgaaggtattatttggagccacatcgattt
tgctgataatcaagatgtgatttcagtgattgaagaccgtcttggtatcatctcgctgctgaacgacgaagttatgcgccccaagggcaatgatgaatca
cttgtgtccaagctttcaaccattcacaaagacgaacaagacgtcattgagttccctcgcacatcgcgcacacagttcacaatcaagcactacgctggag
cagttacatacgaatcattgggcttcctcgaaaaacacaaagacgcacttctacctgacttgtcagatttgatgcgtggctcatcgaaacagttccttag
gacgatatttaccgaaaaagttggcagcccagttgcgtcacgaaagaaaagcaacagcaacgcccgaggtggtcgaggtggggctcttacggtggtaaac
gttggtacccaattcaaggacaatcttaacgagctcatgacaagtatccgacaaacgaaagtgcactacgtccgctgtatcaagcccaatcaaagcaaaa
gccctaatgaaatggatcaaccgatggtggtatcacaactgcgatgtgctggtgtgatcgaggcaattcgtatctcacgagttgcatatccgaaccgact
gctgctagaagaact