Description :
From Genome Similarity Track
Location :
Scaffold_75:28982- 30630
Sequence
1648 bases(100 bases per row)
TGAAGGGTACCTTGCTGCTCGTGAACCTGTGCAGAGGCTTGCACAGTGTGGTCTTGCTGGGAACCATGTCCCTGTAGTAGTTGATCATGCCTAAAAACTG
TCGTAGCTTCTTACGGCTCCTTGGCACGGCGATCTGTTGGATGGCCTGGATCTTCTTTGCTTGAGGCTTGATGCCTTCCGCAGAGAGCGTGTAGCCTAGG
TAGTCAAGTTCTTCGCGCAGTATGTAGCACCTTTTTCCGTTTAGAGTAACATCGTAACGAGCGAGGTGCTCGACGATACGTAGGTGCTCAAGGTGCTCTT
CCTCGTCCTTCGAAAACGCCAGTATGTCGTCTAAGTACACGACAACGAACTCCAAGTCTCCAAAGATCTGCTCCATGCAAGCTTAATACTCATCCAGGGC
GGTCGAGATGGACGCTTGTATTGGAATTTGCCAAACGGCAAACAGAACGCCGTTAGTGGTCGGCTCTTTATCGCGAGCCTGCGAGCGTAATAGCCCATGT
TGGCACCAAACATCGGGATGCACTTTGCTTTCGAAACTCGCATCAGTATCTCACAGATGCGAGGTACTTAGTAGGGGCTCCTACGCAAGTACTTGCTCAA
CCATCTGTAATCGAAAAGTAGCCGAAGTGAACCGTCTTTCTTAACAAGGAAGAATGCGAGCGACGCCATCTCTGAGTCGTAGATCTGTTCCAGTGCGTCG
GCATTAATAAGCCGCTGTATGAATTCCTTAGCGTTCGCCTCTTGGCTGCGTGGAATGGCGTAGGGCTTTGCATGTACCGGCTTATAGTCCGAAGATAGCG
GTATCAAGTAGTCGTTAAACCGCATGCGACCCAAGTGACCAGCGTACAGCGTGCGATGCTCGACGAGCAAGTCCAAGTAACGCTGACCGAGCTTGGCGTT
GAGGAGGTCGGGGAGCAGCTGCTCGGGCTCGACCGAACCGTCAGCTATCTCCTTGGTTTCGTCCATGTATTCGTCCTGTTGGTCTTCGTCCTTCTCACTT
GCTTCACTGGTCGTTCCTCCACGACCCGTATTAAGAAGGTAGCTATACTCTTCCCATTGTACTACCTTGTCCTTGAAGTTCAGGACGAGGCCAAGAGCGT
TCATTATGTCGCGGCCAATAGCCATTGCGTTGTGACTGTTCTCAATCACCTCGAAGCGGTGGGTGATGACGGAGTCCGCCTTCAGCGTAGGGAAGATGAA
CTGCACCATAGTCGTACCGCTACTGGTTACCGAGCCGTTCATCGTCTCAAAGACGGTAGGTGAATCGGAGAGAAACTTTCGTCCCAAGTTCACATTGGCT
GCGAGCGTCGCACCGCTAATGGTGCTCTTCGAGGCACCACTATCGAGTAGAGCGTCAAAGATCTGGCCACTGCGCTTAAACTTTACTGGAATGCGCAATG
GACCTTTTTTTGCTTGCTCTTTCTTCGTCACTAGGTCGACAAACTTGAGCTCTTTATCTTCACTGGCATCTGAGTCTGAGTCGGACTCAGAGTCTCTGTG
GATACGAGGGTATCAAATTATTTTCTTACGTGAGGAAGTTGTCTTCACTTCAGCGCTCCTTTGTTCGTCTTTTTCTTTCTTCTTGACTGTGTAGCAGTCA
CTGGTGTTGTGCGAGTTCGTCTTATGGAAGGAACACCACTTGTCACCC