Description :
From Genome Similarity Track
Location :
Scaffold_200:28982- 39747
Transcript NameFunction/comments
Phyta_totarag5475HECT E3 ubiquitin ligase, putative
Phyta_totarag5476iron sulfur cluster assembly protein 1, mitochondrial precursor
Phyta_totarag5477hypothetical protein PHYSODRAFT_263945
Phyta_totarag5478hypothetical protein PHYSODRAFT_353770

Sequence
10765 bases(100 bases per row)
GCGGTAGCGCAGCACGAGTGATAAATACTCCAGCTTGTTTTCGTCGGTCACATCAATATTACTTCCTCCAGGTTtcagctccaccgtctcACCCGACGGT
GTTTGAATACTGAACGTCACACACAGAGCGCCCACGTGATCATTGTCCCGCACCCAACTCAAGTGCTTATAAAGTTCTTCGTCCAGAAATTCCAGATCGG
AGAAAGTGATGGGGACGCCCAAAAGGTGCTTCAACAACGGCAGCGACATGCTTACTTCAAGCACAAGGCCGTCCAAAATGGCCTTGCCCAGAAGTCTGCC
GGCGAATGTGAAATACTGCACGTGGTCTTGGCCTTCGGGCACACACTTAGCCGATTCCGAGTTGATCCAGTAGCTGGAGTCCTCCGCATGCGTCGTCACA
AAAAGACCTCGTTCGGCGCTAAAAAGCTCTTTACACACAAGTCCGAACCACTCGCGCAacacaccaccagcatccaGGGCTGGTTCGCCGATAAAGCCAA
TGTTTAGGTGCTCCTGCATCCTCGAAATGTCGACGTCATCCCCGGCCAACTGCGGTAAGGAGTCGTCCAAGATGGCAGAACGTAGCACATCGATCTTGAA
CATGGATTCAGTGTACGGCACGGAAAGATTCGTGATCTGTTTGAGGAACCAccgcttcttctctctcCACGTCATCGCCAGCACGCCTTCAAAGTCCACC
AACGGCTCTCCATCACCACTTTTCGGTTCCACGTCCAACGCAACCGAGTCTGTCTTCCGCCACGCCACCGCAGTACCCGAAGCATTAAGCTCCGAGAAAA
ATCCCATCGACGCCGCATTCTTCCGATGCAGTTGCTCTGCCAAGTCTCCATGCAAGTGTTTCGCCTGTGGGTTCTTGGAAAAAAACGAATTGTTCCGTAG
CTTATTCACGAATGAGTCTGCTCGCGCAAAGACCGATCCAGGTGCCGCGGGCGCCATCGTCCTGACCCACACAAAGCCTCCATTCGGCAGAGGCACTCGC
TGCCACAGCCTCCTTCTACTCGCTCCTCTCTGCTTCTGGTTCAACTGCATCTCGTTCAACCTTCTGTACCGCAGCGCTCTCTGTCTCATGCTCGTGGTAG
CTTCCAGTTCTTCGGCAATGTCACCGAACGACGACTCACTGCGTAGCATGGGCAGGGTCTTGGCCTTGTGCAGTGTGGCTGACGCCGTCTTGGTGGAGCC
GTCTGTATTGTCCCCCAGCACCACTGGATTGGAGTCAGAACTGGTGACCAAattctccagcagcgtcgaaCTCAGGAGCGTGCCGTTGTCTGTGCCCAAG
AATGTGGTTCTAGCCACGCGTCGCGTCCTCGCGTGGGTGTGCGGGTCCTCCACTGTCTCCTCCATTGTGGAGAACTCGGCCGACGTGCCGCACAGCAGAC
ACAGCTCGTGGTTCGGGTGGTTCATGTGCGCACATACCAGACACTGCCACTCGCTGCGGCCTGCGTCCAGCACCGTGTCCACCAGGTCTtcgcgcagctg
cagactgcgTAGATCCACCGAGTCGatggccacgtcgtcgtccaggcCGTGGCAGTAGCTGGCACACAGCACGATCAcgcagaacagcagcagcacgcag
acGCCCGCGGCGATCAACGCCCCGCCAAGGGACGACGAGTCGCTCATGAAGGAGGAAGCAAGCAGCTGGTCTCTCGAAGTGGCTTCTGACTCCGGTGACT
TGGGTAATGGCTACCTGCCTGCGGTGCCAGGAATGAAATGAACCTATAGACGAGCTGCCCCTACCTGATACACTTAAACTGGCGCAAATGCAATTGTGCT
CCCAAAAAGTCCGGAATTGCACTGACGTTGGATTGCAAAATTTGAGGTGCTTGTTTTCAGCCAATGGTAGACCAGATTGTCTATTGGTACTTTCGATAGC
GGCGGAAACGTGCGTGTGGGGATGGAGGGAGCGGGTTTGTGTGGGCTGCTTGGGAAGCGAAAGACGCTTATGAGTGCACAGTCTCGAGATCACCAGGGCG
CATGTAAGGAGGCACTATTCTATGCGTTGAGTACGGATTTCGATTAAGATCCGAGACGTCGCCAAATCGCGAAAATCCCACGACCTGACCCGTTCCAGAT
TCTGTTCTCGCCAAGCCAAGCAGCCACTAGCAACCACTCCGTTCGCGGTGAGTGAGTCTCATCGATCCTCGTGACTACCTGCAGCGTGTCAACACCTGCA
GCTTATATGAGCAGCgcgttgtacatgtacaacgcCATATCGCGCTGACAACGAGACATTCGCCACGTGCTATCCGACGTGGCGCGGTTATGAGCGGCAT
CGCCGATCGGCGACGCTGATATCTGGCAAACCTGTTGTGGGGGAAAGCCTTCACAGGACGACGCCTGGCGCATGTGTAAACTCAAGGAATGCGGTGTGGG
GATACGGTTATTGTGCGGCACTCACGGACTAGGTGCCTACATGTAGGATCTGGTACAGGTTGTCGGGGCGAGGCCGAACGCTGTCTGTCTGTTGCGACGG
TTGCATTCAAGTTGATTGACCAGATATCGGTGGGTCAACATGAGCGAGTATTTATTGTCGCTGTAGACTCCAGAGTTGCAGTGAGAGTAACAATTGTCGG
TGTCTGAAGCAACCTGTCAGTGCTAGGGACGGAAGCCAGGCACGATGAAATCGGTGACAAGGCAATGTGGTTTAACAACATCTTCCGTGTGGTGACCATG
GCACCACCTCAGCCGACCAAAGTCTGTTCGAGTCGCAACAAAATGGAGCCTGTTTGGTCTATTGCCCGTGGATCTTAGCGTCCACAACGacaatggcagc
aacagcaacgacataGGCAGTGAAGACAGGAGAATCGCGATGCATCTGTGGTGGCGCTGATCGATCGCGAAGGTAATGCTGAAAGTGATCCCAAACAAGA
GCGCCCTGGCGATGGACCCGTAACGAGGAGCAGTGGTGCTGCAAATGAAGCCCAGCATTCCGTTCGCGGTGAGTGATTTGAGTCATGTCGTAACACACTG
CTCGACTATTAGGCAATGGAGTCTACCCTGGTAACGACCAGTGTCAATATGTTTAGCGCAGAGCTGGTTTGAACGAAAGTTGTCATTGCTGCAGTCACGG
TTTGTACATGTGTAGCCGTCCGTGCATTAACTATAAGCGCCGAGCTCTGCAACGACGCCACATTTTCGTGTTGTTCAATGAACGGTTCAAGCATGTCTTT
AGCCTCGCACGTCCACGAATGAGTGCGGCCACGTGCCTCGCTGCCAGTCAGCACCAGGCTGCCACGTGCCCGCAGCTAATGATACCTTGAGTGCGCTTGG
CCACTCACTAAAGCAACATGAACTTGCTCACGTCCTGCCCGTCCTTGCAGGGAACATACAACACACCGGTGGCTGTTTTCGCTAGCGAAATTTCCGCACG
CTGCGCACACTTACActcgtttgctgctgctgaacgaatTGAACTGCTTCACTGAACTCCACGTCAAGTGAACACCCCCACGGGCTCACTCAGTGATAAG
GACTCGTCTCAATCATTTCCAACAACAATAGAGGGGCTCAAAGcgaactccagcagcaagacgcgcTGCAACTGTTGTGTTGCCACTCAAGGCAGATCTG
GATGGACCTTGTTGGAGGTGACGCATTGATGACTCCCCAGCGCCAACACTCTTGGTCCAAGACTCTTGGAGCGACGCCATTGGAGCTACGAATCAGAGAG
GAGCAAACTAACAGCTCGCGTGCCATGATTTAAACCAGACGTCTGGCCTGAGGCGAGGAGTCAGTTTCTGCCTCTTGACGTGAGACCCACTCAAGCGCAC
GATCGCCTGGACAGGTCAGCAGCAATATGAGCATCTCCTATGGcttggccaagcagctcggcTCCGCAGAAGCTCGTAaactcgcgcagctcgccatTTG
CTGTTCTGGTGGTTACTCCCTCCCGCATTCATTTGTTAAACGGGAGCGTGCGTCATCTGTCGACGTCACTGAATGGCCAAACCTGATTTTAAGCCAATCG
CAGACGAAAATTCGTCGAACCTATCATAATACATAGGATTAGATGTAGCAGTGTCCGCAATTTGATTGGTCAGAGGCACGCGCCCCCTCCCAATAtcgtg
tggtacacacaaGGCATCAGGGCCCTTGAGTGACAGGTCGCTCATTTCGCAACGGAATCCCAGAAGCGAAGGCTACCGAAGCTCAGCAGTTCCCCAAAAC
CTCCAGTCAACATGATCGCTCGCACGGCTCTTAAGCGCTCCCTGGGCTTGTTCTCAGCTGGCCGCACGGCCAACGTCGCTCCCGCCTTCGGCCGGGCGCG
CATGTACCACGAGAACGTGATCGACCACTACGAGAACCCGCGCAACGTGGGTGCCATGGACAAGAACGCCAAGGACGTGGGAACGGGACTCGTGGGCGCC
CCCGCCTGCGGTGAcgtgatgaagctgcagatccaggtggacgagaacgGCACCATCGTGGATTCCAAGTTCAAGACGTTCGGCTGCGGCTCGGCCATcg
cgtcttcgtcggtggCCACCGAGTGGCTCAAGGGAAAGAGCGTGGAGGACTGCCTCAAGATTAAGAACACGGACATCGCGACGCacctgaagctgccgcc
tgtcaagctgcactgcagcatGCTGGCTGAGGATGCCATCAAGGCTGCCATCTCGGActacaagaacaagcagGCCGCGTCGGGTTAAGGTGGCACAGGA
TAGCAACAGccttgtcgtcgctgcgctCGCCTCCACGTCTTTGTTGAGGCAGAAGACTTCAAAATGGACGTGAGCAGCTGGCGCTCCGTGCGGGCTTGCT
TGGCCCCCACCCGAGAAGATACGTCAAAGGAAAGCAACAGTATTGAAGGAGAGAGAGGAAAAGCTGTGAAATAATCAGTTGCTAATTTATTGCCTGCCAT
CGTCGAATCTTGTTAGCTGTTGTTCTCGTTTCCTATTGCGTGGGTTTTTGTAATAGCTGTCGTTTCCAATAGGTTGAATGAAGCTttctactacatgtag
tagtatCGGATAGGTGGCCGCTGAGCGTTGTGGAGACAAAATGTCGATGGATGGCAGCTGCATCACCTTGATGAACAAATGTTGCAGTCAGTACAAGACT
TGATCTCGTTGCGAACACCAAGACCGTCTCCACGGCGTTGATAAGCATCCAGAACTAGAAGGTTGAAGTGATCGTCACTTCAGTATGCACTGGGGGAGGC
CTTTAACGTATTTTATAATCCACAAATCTCACAAgtacagtattaatacatgtaccagacGGAAGCGAGGCAAGCTGTCGTGTCTTGCCGTCTAAATGGG
TCAGCTGAAGCTCCACCTCGTTAATGGCTGGCCACCAACCACTAAGGTGCTTGGCTTCTTTGTTGCGACACCAACTCAGCCGCCTTGGATCTTGCGTCAC
CAAATCGTTGACGACATTGTACACCTCGTTTACCACTATCTGCCTCACTTTGGGGAGTACACGCACCCAGCACGTAACTTTTACTAGAATGTCCGCCATC
CATGCCTTTTTAAAGCTTTAATAAGCTTAATAAATAAAAACTCAGGCCGTTGACTCCACTTCCATGGCCATTTGTCTGCTGCTCTACGTACTGTAATAGC
TCATTTCACGAGATAGCGATGGTGCCAcggccaagcagctccatccaccTAAAGCCTGGACACTCATCGTGGCCGTCGCCGGCGGCCCGGTATGACCCAC
TTAGACCTCAACTTGAAATTGCCTGTGACAAGCTCCATATCTCTTACCACAATAACCTCCACTTTTAGCCAGTAATTTGTCGCTTGCCGCCTTCCGGGTG
TAGAGATTGCGAGCGTAATCCCGAATATCCCGTGGCGCAGTCAGGCGAACAACGCCACGCTGCTTGCTCGCTCGCTCTCTGCTTGGCCAGTTCCAGATTT
CGGTTGGGCGAAGGAAGACCTCCGCCACTAAACTCTGCTGGAGGTGAGGCGCCAATGCTTCTCTGATGTCGGTTACGTTGACTGATTAACTGCCGTATTC
TTAGGTCTGTGTATGCCGAACCACCGCCTCACTGCCGCCGCTAAACGTCCCAAAGCTCCGCGTCGCGGCAAGCCTAGAGGCGCTTCCCccacgcagacgc
agctcgccatggccaccaccGAGTCGCTCCGCACCGGCATCCGCTCCGTGTACCTGCCGCAGCAcatcgtggtgctcgtgcACGGCAACAATGGCTCGGC
CGCAGACTTTGATGCTGTGGAGGCGGCGCTACTGGCTAAATTCGGCGAGCGCCAGCTGCTGATCATCAAGTCTCGGGCCAATGAGCCGGACACGTCGTTG
GGCGTGGAGATCGGCGGCACGAGACTCGCCAAGGAGGTCGTGGAAGCGGTGTTCGAGTATGACTTGAGTCCTGTCGTCAGCAGCTACAAGCTCTCAGTGA
TCGGCCATTCGCTGGGCGGACTCTATGCGAGATACGCCCTCGTTCAGATCATGGACGCACTGAGCTGCCTGCACATGGAATACGTCGATTTCGTCACGGT
CTGCACGCCGCATTTGGGCTCTAGACGGGCGAGAGGACCATCGACCATGAAGGTTGGTGGCACTGGCTGTTGCAGTTGATATATTGTGGGGCTGTGCAAT
CAACTAACTTTGTTGGCGGCGGTTGGTTGCACAGAATATCCTTCGTCTCGGAGTGCATAAAGTACTGGCGTCGCGATATATATACGGACGGACAGGCAtt
gatcttctgctggatgGTGAGTTGTCTTATCGTGTAGCGAGAAACCTCGTCAATTGATGCTGACTTGTGTGATGTATTGTGAGGGTGCAGCACAAGAACT
GCAACAAGAGGGGGTTACAGATGCCGATGCTGTAGAGCCTGCGCGtccgctgctggaagtgatgAGTGACCCTAATTCGGAGTTTGTCCGCTCGCTCAAG
CACTTTCATCACGGCACGCTGGTAGCTATGACGGATGGTGACGTGGTAGTGCCGTACCCCTCGGCTTCCATGCGCAGCCACAGCCCGTATGTGAGCACTT
TCTTGACGGAGCGCTACATGGATTGGCGATGGCATATCCGCCACTCTGGGTTTGTTGAAGGTGACGATAGCAGTCGCACCCACCCTGCATACGCAGCATT
CTTGGAGCGACTTAACTCGAAGATTGATAGCTCGATTGAAATCGAGACGCACGAACTGGGGCTTGATGCAAGGTGCGCTCCAAGGTATCCCAGCATTGAG
GGGTTTGACTGTGACAACAAACAGGAGGTGGAGTTCCCGCACGAGATGCTATGCAGGCTGCAGCGGGTGCTTCCGTGGCGACGCATTGACGTGACAGTGG
AGCCCTGCGGCATGAAAGGCAAAATGCGCCTGCATGACTGGCCGATCAGCAAGATGCAGCCTCCTGACTGCCGTGCGGACGAGTTTATCGATCTGCTGTG
TGATATGATCGGAGCCGACCACGAGATGCGTCCTGTGACGACACCGGATACCGTTGGCAGGTTGCATGAAAGTCCTGCGCTCGCGTTAGCACGCCGACTT
AAAAATGTTGCGAAGCGAACTGGCGACAAAACGATAAGCGAGCAAGGGAGTGTTGATAGTGATGCTGAAGCCCATCACTCGGGGATGACTTCTCCGACCT
CGGGCTCATCTGTAGCGTCGAACGACTTCCCAGTTCAAGTATAGCATGTTAAAAAATCTCGAAATGTACTGGTACCATTCGCTTTGTTTGCTATTGATCG
TACTTGGCTAGGCAGTGTTGCTTCTGCTTTGCGTTCTGCGAGGAGTCTCTGCGATGAAGTACTCAGGTGAAATCTCGATTGACTACGGTTGGAAAAAATG
TATTGCCCGAGATTGTCAGCGTTACTTATCATTGCCGTCTATAGACTGCAGTAGTGGTTTATGTTGCAATTGGCTATTGGAATACTCTCCGTCACCGCAA
TTGTGCCCTGCAATACTCTGTTTTTCTATCCGGGTATAGTTCATTTGAAGAGATCAGTCGAGGACGGTATAGTTGGCTAGAAGCAAGGCTGTAAAAAGCT
CGCATTCGACACGCTCTCTTTCGTGAGATGGTAAGCACTTCAACCTAGAACAGCATCCAAACTCGCAATAACCTACTGCAATACAGAGAGCTTCCACAGT
TGCATATTGCAATCTGCCACGGCCGTGCAATTGGAAATTTGTATTCCAACACTTCTCGCAGTAAGGCATTGCAgtaaaatattttgtacgGCGGATAAac
caagatattttttcgGACCCCTGCTCAAGATTTCCTATCAGAAAATGTTGTGGATAAAACATTCAGCCGCCAAGAGATCGTCCAACTAATTTTGTCATGA
AAACCATGCATACAACAATTAATGGAGGGGGGTCGGACTCAGGGGACAGGGGCTACTACTAGTATCCTGTAGTATAATAGTTCATCTTGCATCAAACGCC
ACCAATGTCGAGTATTTTCCGGACTAAGCTTATGTGTAGCATGGTAAGTGATTCTCTCTATTCATTCCATTTCTAACTGATCGCACTCGTTTAACCCCCG
TTGGCGCCAACACTCCCTCCCCAACGGAACTTCTGCTTCCAAGCCTTTTAGTCGTGCAGTTGTAGTGCGAAGCCTTGCTTCGAGCACTTGGCGCTTGCCA
TTTCACTTTCAGAACAACATCCACGGGAACGTTTCCACGCAAGGCTACGATAAAGAATATTTTTAATCTCCTGTCCCAATCGTTTCGTCTCAAGGCGAGT
AATAACGAGCGAGCATCGCCGGCCCAGACATGCCGAGGTAGAAGACCCAGGAGTCTCCGGAGGCTTCTACCTCGGCATGTCTGGGCCGGTGATGCAAAGT
CAGACGACTGCTTGGTCAACTTTACGCCCCATTGTTTCGCCAGTATAACCTCAAAGAAATggtataccggtatcaaGCACATACTGCTGCAAGCAGGAAC
AACAACCTTCAGAGTACGCCGCCTCCTCGTGGATCACGTCGATGATCGCGATTTTCTCCTTTTTCGCTTACAGTGCCGGCCAGGACTTCAACGTCCCCCC
TTAGACAGCGTGACTGGTGATCTTCTGGTATAACTGGAGGCTGTGTTTGTTGTTGCCCTTGGTCTATTTGTGGCTAATTGTCCTTGTGTGTCGTCATTAA
ACCAAAAACGCTGCTACGTCAGTCTTATCGGCAACGGCTAGCATAACATTAATTAAAGACTGGCGTAACAGCGTTTTTGGTTGAGTTGACAAGCTGCGAT
TGGAGAAATTCTCACACTCGTCAATGTCTTGCGTGCGGTACCCTGCCATCAGCGCTTCGCTTCCTGGTCAGCCAGCCACCACAGTActtgctctgcagca
gcatgttctCGAAATCTTAGTTGCATTGGCGTCATGTTGACCTGAGCACATTGACGGACCTTCTCGAAGCAAAGAATAGAATATTCGATCCAAGCGCAGC
CAATGGCTGGCCTTCGGTCGTCTTTTCCGCCAATCCACGTCCTCtgagatgctgctgcaaaaaAGCTGGCCCTTTTCGCATACCTAGTTGCCGTGATCAT
CAAACGCTGTTCTCTTTTGTCTTGTTGCCTGCCAGTCTACAATTTGCAGATAGCAAGTAAGGCAACAAACAACGAatgagcaacagcaacggatCAAGCG
GACCGAcggcgatgcagcagcagcagcctgcaCAGCCGCACGGCAActtcgttttcttcatcCAACCACCGCCCACGGTCTGGGTGCAGTTCAATGACGG
CATGCAGGTGGCCTTCACGCCGTCTCCGGCGCAGTACCTGCAGTCGATGCTGAACGGCGCCCCTCTCTTCGGATCAGCACCCGGTGTCAACGCCAATGGA
AGCGGCGGTAATGGATTCTTGAACGTACTGAACGATCTGTTCCAGCGCgcgcaggcgcagcagcacggccCGCCACCGACGAGCAAGCCATTCCTGGACA
AACTGCCCGTTAAGGTGTGGACCCAGTACATGCAGGAGACCGAGAGCCGCACGGAGTGCGTCATCTGTCTGAGCGACTACGAGAAGGATGACAAACTTAT
CTCGCTTCCATGCGGCCACACGTTCCACAAGGACTGCGGCATGACGTGGCTCGTGGAACACAACGTGTGCCCTACCTGTAGATACCAGCTGCCCACACAG
GCAGAACCCACTACGGCACAGACCACGACGCAGACAACACCGGCAGCAGTGACGGAGCCGGACCAGGAGCCTACCTCGCAGGATGCCACCTCAAACGTCA
CGGGTgttcgtcgccatcgcccGACAGAAACGTCCCACCCGCGCGACGTCCGTCAGCGTGTGGGCGAGCCGGCATCGGtagatgaagacgcagagTTGGA
TCtcatgctggagcaggaggccGACCACTTCGTCCAGGAAGAAATGGAGAAGCGCCAGTTCATGTCGAATGACGATGGCATCGAGATCGATGACcgcgac
gtggaggagcttcttcacgaaaCGCCGAGCAACTAAGTCGACGCCAACCAGATAGTTCGTGTAAAGTAGTAATCTGGTACACAGCCAAGTAAGAAAGTTC
AATAAATTATCTCGACAATAACGAGCTGTATTATTGAAGTAGTGATCGCATCGACAACAGAAGAAACAGATTATTCATTCGCAGTAGTGAAGTTAACTCT
TAAACTTGAGTGCTCGTGACAAACCTCCAAGTCCTGGTTAATGACCACGGGTAAAACTGAAACTTCTCATCTTCAGTGGTACGTTTGTATCATGCTGGTT
GTGCAGGTGACTTGGCCATTCACTTTTCGCGATTTTGATCGCCTTCTCCAGTCGTAAAACATTTT