Description :
From Genome Similarity Track
Location :
Scaffold_883:2898- 5903
Transcript NameFunction/comments
Phymu_g12252hypothetical protein

Sequence
3005 bases(100 bases per row)
ACTGTATGACGCTGTCAAAATGTATGACGGATGGTGACTGGAACTGGGCGATGGCCCGCCTGCACGTGTACCCCCACTAAAGATCAGGTTGAAGCCGAAT
GCTGCACCTTATCGGTGCAAGGTCCGACAGTATAGCCCGGAGAAGTCCGAGTTCATGGCCGACTTCAATAAGAAGCTCGTGTCACTTGGCTGGGTATACG
AGAGCAGAGAgagtcgctggtgctgcccTGCTCTACCTGCGAAAAAGCCTAACACCGGTGAGTTCAGGCAGACAGTGGATTATCGACCGACCAATGCAGT
GACAGAGCCAATCGCTGGTGTAATGCCAAGCCTTGAGGTGGCTCTTGAATACTGTAAGGGCAAGATGGTTATGCAGTGTTCGACTTCCTGAAAGGGTTCT
GGCAGCTACCTTTGGACAAGAGCTGCCAGGAAATCCTCTCCTCCATGACAGACCGAGGTGTATTTACACCAACCAGAGTACCGCAGGGCAGTACGGATGC
TGCACTGCACTTTCAGGCCACAATTGAAATGGTATTGGGTGATCTAGTGAATAAGTGAGTTATCGTGTGGATTGACGACTTATTGGTTTTCGCGGACACT
GCAGAGGGGCTAGTGTATGCTATTGATGCGATCCTAGTGAAAATTGACGAGCATGGGCTCATACTCAACCCGAAGAAAAAGCGAACTGTTTCTGGCAGAG
GTACGGTGGTGTGGACGTATAATTAATCGAGATGGTATCGGTAATGATCCAGAGCGTATCCAAGCTCTACGAGATATACCGGTACCAACCACCGCCGCTG
ACCTACAACAGTTTTTGTGCGCAAGTAACTGGATGTGGTCTGGACTTGTGGATTATGCGAGAGTGGCTCGGCCTCTGCAGTAACGTCTCGATGCTGCCCT
CGCAGGCACAAAAAAGACTAAACGGGCTGCTGCAGGTATCAAACTGGACCTGACTCCGGATGAGGCTGCGAGTTtggaggccgagaaggaaCTGCTTCGC
AATTCGGCCATGCTGACCTTCCCAGACCCTACCAAGCAGTTGTGTGTCCTTAGTGCCGCTTCTGACAACAAGTGGGGGCTGGTCGTTCCTCAAGTGAAGC
AGTGGCAACCCGATGTGCCCATCCACGTGCAGCATCATGAACGGCTTGTGTGCATGGGGGGCAGCTTCACCGGTTCTGCTCTCAATTGGGGCGTGATCGA
GAAAGAATCCTTCCCAATCGTTCATGCCTGTGAACGACTGGAGTACCTACTGCTACGACCTCAGGGCTTCAGGCTATACTGTGATCACAGAAACATCATA
TACCTGTTCAGCCCCAGCAAGGAGCTGAAAAAGCATGTGCGCGGCAAGTTATTACGGTGGTCTACGAAGTTACTagagtaccggtacacgATCGAACACA
TCGAGGGCGTGGATAACGTTTGGGCAGACTTGATTTCACGTTAGGGTGGTGGATTTAAACCTGCAGCGCGCATGCACTCAGCAAAACGGTTCACCCGTGC
AAAACGGAAGTACGCGGAGACTTCTAGGACAGTTGAGGTGGTGCGGTTGCGCCCGCTTGACGACGAAAGCTTCGTGTGGCCTACCATAGAGGGGATTGGC
AGCCAGCAAGCGTTGCACACTGCTCCTAAGGGTGATTTCTCTACGCGATGATGACTTGTGGGAAGTTGACGGGAAAATATGGATCCCTAGAGAGGCAACT
ACTCTAACACAGCGACTGACGATCATTGCGCACTGCAGACAGAATGGCCATCGTGGTATGCACGTCATGCAGAACCATATTCGACGGTTGTTCTCAATTG
GTGATCTTAGTGGGATTGTTCGCGACTTCTGTTCGAAGTGCTTACTTTGCCTGCATGTGAAGGGTGGGGTTGTGATACCTCGACCATTCAGCGAGACACA
TCATGCTTTTGAGCGCAATACGTCTTTGCACTGGGATTTCTTGTCTCTCGGTGAATCATTTGGTACATCACGCTACTTATTGGTGTTAAAGGATGAGGCC
ATGCATTTCATCGACCTGGTGGCGTGTGACAGTGCTACTTCTGAGGTAGCTGCGAGTGGCATGCTAGATTGGCACAGCCGCTTTGGTACACTGAAAGTGT
GGGTGAGCGACACGGGATCGCACTTTAAGAACAAAGTGATCGCCGAATTGAGCCGACGCCTGAAGGGTCGCCAAGATTTCATTCTAGCCTACACACCGGG
GAAGAATGGCTCAGTGGAGCGTGTAAACAGGGACATTCTGCAAATGCTCAAGGCACTGGTTTTGAAATTCAAGGTTAACATATCAGACTGGCCCTACCTA
ATGCCACTGCTACAGTCGAGCATCAATCATTCTCCGGTCCCGTCACTAGCGAACCATGCACCGATTGAGTTATTTACGGGACTACCATGCCCCAGTACAC
TGGACACGGTATTTCTATCTGGAGGGAAGGGACGTGTAGCAACACTGACTCAGCCACAACCAAAGGTCGACGAGCTCCTAGCTAACCTACGAGAGAGCAT
CGTGGTCATGCACAAGGCAGTGACGGCtgagcgccaacgccaaaCCAAACGGTACAGAGATCGGTCCCACGATGCACAGAAGGTCAACTTCTTAATCGGT
GACTACGTTTTACGGTCACGTGTGGATGACAAAGTGCACGCAAACAAGTTGCATGTAGTGTGGGTTGGTCCCTATCGCGTGGTGGGCAGTGCAGACTACT
ACTTCACAGTAGAACACCTGGTGAACGGCGGCACAATGGACGTGCACCCATCTCGCTTGAAATTCTATGCAGACGACTCACTCAACGTCAACGAGGAGTT
AATCGACCATATCGCTTCCCAGGGAACTCTATTTGCTGTGGAGAAGTTTGTGGATCATCGTATGAACGCAGACATGGAGGTGTATGAGGTAAAGGTCAAG
TGGTTGGGCCTGGAACCCATAAAAGACACCTGGGAACCCCTGAAGACGATTGCAGAAGATGTGCCCCAACTACTCCAAACCTACGCAAACAGCTCCAATG
ACGGC