Description :
From Genome Similarity Track
Location :
contig_6:289780- 291757
Sequence
1977 bases(100 bases per row)
CATCATGCTGCACCAAGCAGACCACTGCTCCCACGCTCGTGCATAGTATTTTCTGGACGATTGGGCTAAAGCCCTTGCTCCCCAAAGATTTGAGAGATCG
CGCAAGTCGTCCGGGATCTGAACCTGTTTCCAATCAGAGCTCAAGTTAGCAAACATAATGGCCAAAGATGGCGACCGCCACGCCCTGCTGCATGCGCCTG
CCATGATATTGTCCACACCGGCTATGTGAGAGGCTGATGTATAGAACCCGTACTGGACTTCGCATATGGAGAGAATGCGAAGCAGCATTTGAGCGATACT
ATTTCGACGTGACTTGCGGTTGCTCCAAGCCACAGCCGAAGTGTTATCAATCCAAAATTTTACATGGGAATCGCTTTTAACACCGGGACTCTTCCACACA
GGCCCCCATACCAGAGACGCAAAACCCGCACTCATCAACTCCCGTACGTTGATGCAGAATGTGCTATCGCCGGTCTCATTGCAGAAATTAATGAGCCGCG
TTTCTTCCACCGTAAATTTTACTTGCAGGAACTCTCTTCGTGCCGGAAACAAGGCGCATAGCCCTTGGTCACTGGCGTTCATTTGGATGTGGTAGTCAGG
AGCGTGGCGACACGTGAAACGAGACAGAGGAATTGCATTCAATCTTCCAATTCGAATAATGATCTCGAACCACCGGAGATCATCTTTTGTGTCCTCGGAG
ACAACTACATATCCGAACCGTGGTGCGCTGCGTGCTAGAGCTGCAACCCGTTGGAAAATGGGTGCTGCCGGCCTGATGCATGTAACCACGTGACGAAGAC
TGCCCAGAAGCTTCTGTAATTCGGTTCGTGTTGTTTTCGTTCTGGCGCCCATGATATGAAGGTGCTCTAGTGCTTTTGTCACTTTTTCCGGTGGCATCGA
GACATTTTGAGCAGCTAGAACCCAGTCGAGGCCCAAAGCGCGACCGGTTTTGAACCATCTTGTAAATTTCTTCTCGTTGGATGCCTCAGGTCCACGTATA
GTGATCGTTGCTGACCGGAGTGCAAGTTCAGCCTCGCTTAGCCCGGATCCAATATCGGGCTCAATAGCGATGTGGTCATCGCACCACGTCTTCGCATCGA
AGTTTGCCTTTGCTTAAGCGGGTTGCAGCGGCCAAGAAGGGGCTGGACTAGCGTATAAATGTCCGATAGCTCCACCCGCAACCCAGTATGATGACGGCGA
ATTCTTCCAGCCGAATGGACAACATAGATCGATGACCAGCACTCCAAGCTCGGGAATGGTTCCGGAAAACCGCCCAACATGATCAGCTGACATGGGAATA
TTGCGAAACGCTCCGTTCACGTCCCCGGTCAACATTCGCTGTAACGCAGGAAATACATCCGCAACGTTAATTATTCGGTTAGCCAAGGCGTCAGGGCCAT
CGTAGCTCACGTTCACCTCATGATCCGGCCCCGTGTTGTCATTCACAGACTCACCAGGAGGGAAGGAAAGGTCATGGATGATTCGAGCATCGACACAGAG
ATCCACATCGCCTTTTTGTACTGCTCCGAACGGACTGCACGTGACGTCCCGTAACAACGAGAGCAGATCAATGTCCAAGATGAGATAGCGATTCGAGTCC
TGGCCCGCACGAAGATGCTTGACAATGATGTTGAGGGCGCGATTATCTGAGCCGTGGTTCGCTGGCACTGATGACTGTGGCTTGAACGGCGTTTTCCATG
CTGGAATAACGCCGTGACACACGATACGTTCCCACTGGGGTTGATATCTGTAATTTTTCCAGGTGGGCTTATTGAAAGGTTCTTCCAGAGACTTGTTCGG
ACGGGGGTCAAGGACGGACTCACCTCGTAGTAAGCGGACAAATTCCGGCAACGACATTCCCGTGCGGCGAATAAACTCACTGTATACGGTTTGCTTCGGT
CGGTCTAGCAGATATGACACTCGACCGTTCTCCGTGACCGAACTTGGTGTGCGTGTCGGGGTTACCAGTCCTTGTTG