Description :
From Genome Similarity Track
Location :
contig_32:28978- 31036
Transcript NameFunction/comments
g6150.t1hypothetical protein PHYSODRAFT_285084

Sequence
2058 bases(100 bases per row)
CGCGCTTGAGCAGAGCTGGTCTCTGCATCACCACTAGGCGAAATATGCAGCCCATGGCTCTTGGCTGCTCTGATAAACCGATCGCACATTGCACCGTTCA
ATACCTTCGGCATCAGGTCTAGCAGCTCTCTGCAGCCCGGGTCTCGAAGGAGATCACAGATCCCACCCAGAGCTGCGTCGACGTCTTCCCCTGCGTGAAG
TTGTCGAATAAAACCATAGAGTTTGGGTACGTCTGATGGCTGGAGCACTTTCCTTGCCACGGTAGGAAACTCGGCCGCAAAAACTTTCTCGCCACCTCTA
TCTCCTTTCGGAATACCAGTGCTGGGCCTTGTTTGGCGGTGAACTGCTGCTTCGCACTTTGCCACGACTGGGCGTCTTCATCATCGAGAACAATCGCGCT
GGAAGCAGTGCCTCCAGTGCTTAGCATCTTAGGTGCCGTGAACGGACGAGAAATCGACGACGTTGAATCGACCATTGTAGACTTGGATGATGACATCAAT
AACGAACCCAGCGTCCGCTTTTGCTGTAAGACTTGCCTCGATTGGATCGGAGGCTGAAGCACCCGGTTCCTCGGTTCTATTAAGACACATAGGTTAGCAC
ACATCAACTGGCGAGTTCGAGCACATTCATTCTAGAGTATTCAGAGCTGCAGTAGCGTACCTGTTGTCGTCTCTGATGGTTCAGGTGCGTGACGAAGAAG
TTCTGGGTTCACATACGATTGGCCATCTCCAATTGCTGTTTGAGAGCTGGAGCCTGACGGGTCTGATGCAGTTAACTGCTGGCTTATCTGTTCAGAATCG
CTGTCGGACGATGCCTTGGATTTTGAGAATGCCCTCTTGGACAAGCCAATCGATTTCGGCTGCTGAAGAATCTTCTTCACAGATGTCTCTGGAACTGCTC
TTGCTTTGTTGCTCTTAAAAAATCGAGTCAAACCAATGTGCGCTTCACCTACAAAACAGTCCACACTTCGTTAGGGTCTCGTGACGATCATGGGCTCGAT
GCTGAGAGATAATGCACGAACCGTAGCCTCTGCATGTATGGCAGTAGGGTTGCAACCACTTCGAAAGGCACTCCTGTTGCTGCTTCAATGCAAATCTCTC
ATCCAACAGAACGATAGCTCCGTAGTCGTGGCGGTGACGAATGACACGACCAATTGCTTGGTTCACTGCTCGTGATGCTTGCTGAATATACCATGCATTC
CCTGTCAATTTCTGGTGAACACCAACGAGCAATACTGTTAGTCGATGTCTGCAACTACAGTGGCAGCCAACATTTCATACCAGCTCTCCAGGAGGTACCA
TGGCTTCATCTAGAATGCTCTTCTTCAAAACGATTTTTGGGTCTTTGGTTGGTGGGAAAGGCAAGCCGGTGATGACCACAGCACGACCTTTGTGTTAGAG
AAATCAATGCCTTCGCTCACCTACACGATAGAGTTGTGAATGTCAGACTGATAGCCAAGGACCCAGTGATATAATTTGTAGTAGCAGTACCTTTCCTCGA
CACACGGCAAAAAACGGCGCCCTTGGGGTTGTCCGAGATAGCTTGATGATATTCATCAACCACAGCTTTGAAATCTACTCGACCCCGTGGCTCCACAAAC
GTTTGTTTTTGTTGGACAATTCGATCCCAAATAGAGGAGGTTGACTCGCCGACTGCCGGACGCTTCCACTTGTCGATACTTTCTTCCAAAATGGAGTACG
ACGGGAAGAAAACGAGCAAGCCGTGCGGGACGAGTCGAGTAAAATTCACGATCGTGTTGCCCAGCTCTAGCAGGTACAGCTCCGTCGACCGGAAATTGTA
GCTCGAATTTAACCTTTTGCCGGTTACACCAGTACCAACAACACCAACCCAAACTTGATCCGCGTCTACCACGTGGTTGTTCTCAAGTCGCACTGGAAAA
TCAATACCCAGCTCCTTGACCGTCGTATCCAATGGAGAAAGTGTACCACTACACCGTGCATACCTTGTCAGTTATCGAGCCCAGAAATCCCTGAATGGGG
AAACATCTACAAACCTGGTCAAGATGACGTTGTGGACGTTGTTGGCACAAATTTCACG