Description :
From Genome Similarity Track
Location :
contig_6:289775- 291752
Transcript NameFunction/comments
g2110.t1hypothetical protein

Sequence
1977 bases(100 bases per row)
CATCATGCTGCACCAAGCAGACCACTGCTCCCACGCTCGTGCATAGTATTTTCTGGACGATTGGGCTAAAGCCCTTGCTCCCCAAAGATTTGAGAGATCG
CGCAAGTCGTCCGGGATCTGAACCTGTTTCCAATCAGAGCTCAAGTTAGCAAACATAATGGCCAAAGATGGCGACCGCCACGCCCTGCTGCATGCGCCTG
CCATGATATTGTCCACACCGGCTATGTGAGAGGCTGATGTATAGAACCCGTACTGGACTTCGCATATGGAGAGAATGCGAAGCAGCATTTGAGCGATACT
ATTTCGACGTGACTTGCGGTTGCTCCAAGCCACAGCCGAAGTGTTATCAATCCAAAATTTTACATGGGAATCGCTTTTAACACCGGGACTCTTCCACACA
GGCCCCCATACCAGAGACGCAAAACCCGCACTCATCAACTCCCGTACGTTGATGCAGAATGTGCTATCGCCGGTCTCATTGCAGAAATTAATGAGCCGCG
TTTCTTCCACCGTAAATTTTACTTGCAGGAACTCTCTTCGTGCCGGAAACAAGGCGCATAGCCCTTGGTCACTGGCGTTCATTTGGATGTGGTAGTCAGG
AGCGTGGCGACACGTGAAACGAGACAGAGGAATTGCATTCAATCTTCCAATTCGAATAATGATCTCGAACCACCGGAGATCATCTTTTGTGTCCTCGGAG
ACAACTACATATCCGAACCGTGGTGCGCTGCGTGCTAGAGCTGCAACCCGTTGGAAAATGGGTGCTGCCGGCCTGATGCATGTAACCACGTGACGAAGAC
TGCCCAGAAGCTTCTGTAATTCGGTTCGTGTTGTTTTCGTTCTGGCGCCCATGATATGAAGGTGCTCTAGTGCTTTTGTCACTTTTTCCGGTGGCATCGA
GACATTTTGAGCAGCTAGAACCCAGTCGAGGCCCAAAGCGCGACCGGTTTTGAACCATCTTGTAAATTTCTTCTCGTTGGATGCCTCAGGTCCACGTATA
GTGATCGTTGCTGACCGGAGTGCAAGTTCAGCCTCGCTTAGCCCGGATCCAATATCGGGCTCAATAGCGATGTGGTCATCGCACCACGTCTTCGCATCGA
AGTTTGCCTTTGCTTAAGCGGGTTGCAGCGGCCAAGAAGGGGCTGGACTAGCGTATAAATGTCCGATAGCTCCACCCGCAACCCAGTATGATGACGGCGA
ATTCTTCCAGCCGAATGGACAACATAGATCGATGACCAGCACTCCAAGCTCGGGAATGGTTCCGGAAAACCGCCCAACATGATCAGCTGACATGGGAATA
TTGCGAAACGCTCCGTTCACGTCCCCGGTCAACATTCGCTGTAACGCAGGAAATACATCCGCAACGTTAATTATTCGGTTAGCCAAGGCGTCAGGGCCAT
CGTAGCTCACGTTCACCTCATGATCCGGCCCCGTGTTGTCATTCACAGACTCACCAGGAGGGAAGGAAAGGTCATGGATGATTCGAGCATCGACACAGAG
ATCCACATCGCCTTTTTGTACTGCTCCGAACGGACTGCACGTGACGTCCCGTAACAGCGAGAGCAGATCAATGTCCAAGATGAGATAGCGATTCGAGTCC
TGGCCCGCACGAAGATGCTTGACAATGATGTTGAGGGCGCGATTATCTGAGCCGTGGTTCGCTGGCACTGATGACTGTGGCTTGAACGGCGTTTTCCATG
CTGGAATAACGCCGTGACACACGATACGTTCCCACTGGGGTCGATATCTGTAATTTTTCCAGGTGGGCTTATTGAAAGGTTCTTCCAGAGACTTGTTCGG
ACGGGGGTCAAGGACGGACTCACCTCGTAGTATGCGGACAAATTCCGGCAACGACATTCCCGTGCGGCGAATAAACTCACTGTATACGGTTTGCTTCGGT
CGGTCTAGCAGATATGACACTCGACCGTTCTCCGTGACCGAACTTGGTGTGCGTGTCGGGGTTACCAGTCCTTGTTG