Description :
From Genome Similarity Track
Location :
contig_59:28973- 30065
Sequence
1092 bases(100 bases per row)
GAGGTAGGTAAAAGTTGATTAACTTTAGCTGGACTTACGTCTTGCAGACCTATGCTATTACTAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTT
GTCGTGGGAGGTTAGGAAGAAGTGCAGTCTGTTCTGACACGAATCCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGA
ATGCCGAAACAGGAAATGGCAGTGGCTTCGAAATGAAGCCTGCAAGTTAGCGACATTTGGCGTCACCGCTTGTGTTTCGCCGAAGTAAATGTCATTGCGC
AGCCGCCACGTTGCGTGAAACACTATAGCAGTGTGCATTCTCCACAGTAGCAACAGGTTCTCCTGATCGCCTCTCCATCCTCTAGCAACATCTCTGTTGG
ATGGGAACAGCAGAAGCTTCCACTCCAAGGTGCTTCGAAAAGCCCTTCGCCATTGACTCCACAATATTTGCCACATTTGCGTTAGCGCCGGACAAGTGAG
AAAACAATGTTCCAATGTTTCAATTGAATCGCAGCCGTCCCGGACACAAAGTTGTGCATTCGGATTGCTAGTAAGCATGAAGAAGAGCCTTGATCCGACA
ATGAGGTCTCCAAAGAATAGCCTTAGCATTAAATCGTGAACGACAGGTACCAGACACCGTCGAAGCCAAAGTACCTGAGTAAGCGTTTGATGTACACGCC
CTCGGGGACATCCAAGTTGTATCATTGGGTGTTGCTCCAATTCGTCGAGAGGCTGGATGAGTTTCTTCCAGTCTCTGGCTTTTAGGCCAGGAAAGAACCG
TGATCGTGATCCTTCAGGAGTGCTTGCAGTCACCACCACCCCTAGAGATGGAGGTGTTGTATTGCTAACCGCCCTTCGCAACCCACCCGCTTCCGGGTGA
GGAAGAACCCGCTGATAAATACTTCGCATTTGATAGTAGAGTACGAAAATATCGCGGAGCAATATGCGTGAACCCAGCTCGGGTTCCACGATGGAACAAA
CCATTTCGAAAAACTCCCCTGAACTTAGCCAGTGGCGATCATTATCCAGAAAATCAGCAAGGCAATGCTTGTTTGCCTTCGCGAGAGCCCGA