Description :
From Genome Similarity Track
Location :
contig_59:28970- 30062
Transcript NameFunction/comments
g11030.t1hypothetical protein

Sequence
1092 bases(100 bases per row)
GAGGTAGGTAAAAGTTGATTAACTTTAGCTGGACTTACGTCTTGCAGACCTATGCTATTACTAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTT
GTCGTGGGAGGTTAGGAAGAAGTGCAGTCTGTTCTGACACGAATCCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGA
ATGCCGAAACAGGAAATGGCAGTGGCTTCGAAATGAAGCCTGCAAGTTAGCGACATTTGGCGTCACCGCTTGTGTTTCGCCGAAGTAAATGTCATTGCGC
AGCCGCCACGTTGCGTGAAACACTATAGCAGTGTGCATTCTCCACAGTAGCAACAGGTTCTCCTGATCGCCTCTCCATCCTCTAGCAACATCTCTGTTGG
ATGGGAACAGCAGAAGCTTCCACTCCAAGGTGCTTCGAAAAGCCCTTCGCCATTGACTCCACAATATTTGCCACATTTGCGTTAGCGCCGGACAAGTGAG
AAAACAATGTTCCAATGTTTCAATTGAATCGCAGCCGTCCCGGACACAAAGTTGTGCATTCGGATTGCTAGTAAGCATGAAGAAGAGCCTTGATCCGACA
ATGAGGTCTCCAAAGAATAGCCTTAGCATTAAATCGTGAACGACAGGTACCAGACACCGTCGAAGCCAAAGTACCTGAGTAAGCGTTTGATGTACACGCC
CTCGGGGACATCCAAGTTGTATCATTGGGTGTTGCTCCAATTCGTCGAGAGGCTGGATGAGTTTCTTCCAGTCTCTGGCTTTTAGGCCAGGAAAGAACCG
TGATCGTGATCCTTCAGGAGTGCTTGCAGTCACCACCACCCCTAGAGATGGAGGTGTTGTATTGCTAACCGCCCTTCGCAACCCACCCGCTTCCGGGTGA
GGAAGAACCCGCTGATAAATACTTCGCATTTGATAGTAGAGTACGAAAATATCGCGGAGCAATATGCGTGAACCCAGCTCGGGTTCCACGATGGAACAAA
CCATTTCGAAAAACTCCCCTGAACTTAGCCAGTGGCGATCATTATCCAGAAAATCAGCAAGGCAATGCTTGTTTGCCTTCGCGAGAGCCCGA