Description :
From Genome Similarity Track
Location :
Scaffold_1119:2897- 6779
Sequence
3882 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCCTCCTCCTCCTGACCCACACCCTT
CCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCTCAAGAAATCATAGAATAATGCTCCACAGCTCAGATCTGCCTCGTCTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTCGGTTTCTCTTCTTGGTGCTGCATACGGGGATGGCCGCTTCTAGGGTGGATTTGGGATCC
CACCCATGTACCAAGTAAAATGGGGTATTACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCT
GATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTGGGGGACGATATGCCATGGCTGCTCG
CTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATGAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGG
AAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCAGTAAACAGGTCCACCCAAATCAACA
ATACTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCC
TTCGATTGTGGGCCTGCCCTTGCCTCTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGG
ATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTC
TCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAG
GATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCT
CGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGCTGGATCCAACCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTT
CCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCCCCACTTCAACACCACATTGATTCCGTAAA
GCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCC
GTAACAGTGTTAGGGCAGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTG
TCCCTTTAGTAGATCCAAACCCAGCGATAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACTACTTCCCAT
CCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTATGCGAGCGGATCCATCGAAAACGCAGGACGTACAGATCCCTCGTCTGCCTG
TACTGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAAGTGTGATGCTCGC
GGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGT
AACCCGGCCGACTTGAACAGCCAGGCTAACGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAGCACGCGCA
GGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTC
TTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATC
CTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTC
TCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGC
TTGTTGGATTTTGATCCGGACAGCTGAAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCATATAGTACTGCAGCAAACAGTGCATAATCCTCGATG
AATCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAGTTCTGCCAACGAAGACAGGTCTTTAGGATTCG
CCTCCAGCCCCTCCTTGGAGACTCGATGATCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACA
CGCCTCCAGTAGGGATGTCACGCTTTCGCACAACTGATCCCACGATTCTGCCGGGATTAGAATGTCGTCGATATAGATCTGTGTCCTAACACAGATGGAG
TCCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGACCTTCCCCGAGTCAACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCGTA
GAGGGCGTTATCGATCAGGCGTTGATAGATCTGGGGCGCATTCTTCAATCCAAACGGTGTGATGAAAGCGGATATTGCGCGAGCTCGATTCGTCATAGTC
ACCACCCAGAAACCACTGGTCATGTCAGAGACAGTACCAAAGTACTTTATCCATCTCATAGCTCATTGATTAGAGGCATTGG