Description :
From Genome Similarity Track
Location :
Scaffold_40:289693- 290827
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012154candidate polysaccharide lyase related to fungal pectin lyases

Sequence
1134 bases(100 bases per row)
TACTTGAGGTCGCCAACGCCAAAGTTCTTGGCGCTGAGCGCGTGCTTCTTTGGAGCGGCCGCCTTGTAGACGGCGACGCCCTTCATGCGCGCCGCAGCTG
CGCTGTCCCGGTTGCTCACGATCTTACCACTGTTCGCGACCACGTTCTGGACACACTGGCGGCCCAAGTACTGCGAGCACAGCGACTGTGTGCTGGACGT
CGGTACCAAGACGGCACCCGTGGTCTTGCTATCGCGCAGTTCGGGTCGGTCGTGTCCTGGAAGTAGTTGCCTTCCATGAGCACGTACGCGTCGCTCTGCA
CTCGAAGAGAGCCTGAGTTCGAGTACCAGTAGTGTGACAGCGTGAGCGACGACATCGTCTGACTCCCGTGAGCCACGAACTTTGGCGAGCGGCCCGANNN
NNNNNNNNNNNNNNNNNCTGGCGACAACCAACGAAATCTTGACGTGGTCGATCCACACGCGTTCTTGAGTGGCGCCCGTCGCCGTGCCTTGGAGATAAAG
GGCATCACCACCCCAGATCAAGTGAGGGTTCAAGTTAGTGATGTGGATGTTCTGGACGATGACGTTGTTGCCCTGAATCCAGAGACCCTTGCCAATGATC
ACACCCTTGAGGCCATCACCACGCAAGGTCTTGTTGCTGTTGATGATCAGCGGGTTCTTGGTACCGGCGACGTCGTACTTCACAGTGACCGCCTTTCCCT
GGATGCAGCCACCGGTGTTGGCCATGCCGCCGCTTTGGAGGATCACATCCTGGCCCTTATGGCCGTCATTCTTCGCGAGACACTGTTGGTTCGAGAGTGG
ACGGCAACCAGTCTCGGTTTTCGTACCCTCACTCCCACGGAAGTCGAAGGTCTTGTTCAAGATGATCACACGCGGCTGGCTGTCCGAGAGGTACGACTTG
AGCTGCGCGATCGTCGTCGGGTACACTGGGGCCGCGTTGCCTCCGCCGGTGGTGCCAGCAGCAAGACCAGGCGCCGTGCCGATCGTGAGCGACGTGACCG
TTTGCACGAGGAAGGCCGCGACACACAAGACGCCGTAACGGATGAGCTTCATGATACTGGGAAGAGTTCTGGGAGTGGGGCTTCGTTTGCAGACGAGTGC
AAATTGGAGAATGAGATCGAAAGCAGCGGACCGC