Description :
From Genome Similarity Track
Location :
contig_32:28967- 31026
Sequence
2059 bases(100 bases per row)
GAAGGCGTTCGAAGAACGTCGACATATCCGTAGCCCGCGCTTGAGCAGAGCTGGTCTCTGCATTACCCCTAGGCGAAATATGCAGCCCATGGCTCTTGGC
TGCTCTGATAAACCGATCGCACATTGCACCGTTCAATACCTTCGGCATCAGGTCTAGCAGCTCTCTGCAGCCCGGGTCTCGAAGGAGATCACAGATCCCA
CCCAGAGCTGCGTCGACGTCTTCCCCTGCGTGAAGTTGTCGAATAAAACCATAGAGTTTGGGTACGTCTGATGGCTGGAGCACTTTCCTTGCCACGGTAG
GAAACTCGGCCGCAAAAACTTTCTCGCCACCTCTATCTCCTTTCGGAATACCAGTGCTGGGCCCTTGTTTGGCGGTGAACTGCTGCTTCGCACTTTGCCA
CGACTGGGCGTCTTCATCATCGAGAACAATCGCGCTGGAAGCAGTGCCTCCAGTGCTTAGCATCTTAGGTGCCGTGAACGGACGAGAAATCGACGACGTT
GAATCGACCATTGTAGACTTGGATGATGACATCAATAACGAACCCAGCGTCCGCTTTTGCTGTAAGACTTGCCTCGATTGGATCGGAGGCTGAAGCACCC
GGTTCCTCGGTTCTATTAAGACACATAGGTTAGCACACATCAACTGGCGAGTTCAAGCACATTCATTCTAGAGTATTCAGAGCTGCAGTAGCGTACCTGT
TGTCGTCTCTGATGGTTCAGGTGCGTGACGAAGAAGTTCTGGGTTCACATACGATTGACCATCTCCAATTGCTGTTTGAGAGCTGGAGCCTGACGGGTCT
GATGCAGTTAATTGCTGGCTTATCTGTTCAGAATCGCTGTCGGACGATGCCTTGGATTTTGAGAACGCCCTCTTGGACAAGCCAATCGATTTCGGCTGCT
GAAGAATCTTCTTCACAGATGTCTCTGGAACTGCTCTTGCTTTGTTGCTCTTAAAAAATCGAGTCAAACCAATGTGCGCTTCGCCTACAAAACAGTCCAC
ACTTCGTTAGGGTCTCGTGACGATCATGGGCTCGATGCTGAGAGATAATGCACGAACCGTAGCCTCTGCATGTATGGCAGTAGGGTTGCAACCACTTCGA
AAGGCACTCCTGTTGCTGCTTCAATGCAAATCTCTCATCCAACAGAACGATAGCTCCGTAGTCGTGGCGGTGACGAATGACACGACCAATTGCTTGGTTC
ACTGCTCGTGATGCTTGCTGAATATACCATGCATTCCCTGTCAATTTCTGGTGAACACCAACGAGCAATACTGTTAGTCGATGTCTGCAACTACAGTGGC
AGCCAACATTTCATACCAGCTCTCCAGGAGGTACCATGGCTTCATCTAGAATGCTCTTCTTCAAAACGATTTTTGGGTCTTTGGTTGGTGGGAAAGGCAA
GCCAGTGATGACCACAGCACGACCTTTGCTGTTAGAGAAATCAATGCCTTCGCTCACCTACACGATAGAGTTGTGAATGTCAGACTGATAGCCAAGGACC
CAGTGATATAATTTGTAGTAGCAGTACCTTTCCTCGACACACGGCAAAAAACACGGCGCCCTTGGGGTTGTCCGAGATAGCTTGATGATATTCATCAACC
ACAGCTTTGAAATCTACTCGACCCCGTGGCTCCACAAACGTTTGTTTTTGTTGGACAATTCGATCCCAAATAGAGGAGGTTGACTCGCCGACTGCTGGAC
GCTTCCACTTGTCGATACTTTCTTCCAAAATGGAGTACGACGGGAAGAAAACGAGCAAGCCGTGCGGGACGAGTCGAGTAAAATTCACGATCGTGTTGCC
CAGCTCTAGCAGGTACAGCTCCGTCGACCGGAAATTGTAGCTCGAATTTAACCTTTTGCCGGTTACACCAGTACCAACAACACCAACCCAAACTTGATCC
GCGTCTACCACGTGGTTGTTCTCAAGTCGCACTGGAAAATCAATACCCAGCTCCTTGACCGTCGTATCCAATGGAGAAAGTGTACCACTACACCGTGCAT
ACCTTGTCAGTTATCGAGCCCAGAAATCCCTGAATGGGGAAACATCTACAAACCTGGTC