Description :
From Genome Similarity Track
Location :
Scaffold_176:28961- 30636
Sequence
1675 bases(100 bases per row)
AGGCTTTTGACCGGAAGCGAACTTCGTCAATTGCACACTAACGATATGGCACGTACGACTGCATTGAAGACCTTGTACTTGAGTTTGTACTCGGTGGAAT
ACAAAAGCCGAGTCATAACGTAGCTGGGGGCGACACCGGAGTAAACTTCGTTAAACACATTTGGGAACTGTGCAGACGTCGCAGATAAGACANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTGGTGTTCAGGCCTCCTAGATCCAGCGACGGTACCAGATCCAAATACAAAGCACCACCTGTCGATTTCGTCACAATAA
TTCCGGGAGGTTTGCTTGGCGCGCTTGGGGCTCGCGTGGTGAATGTCACTGGTATTGTTATTGCTCCAAGGATGCCTTCAGTATTCATCGCTCTCACTGT
GACAACGTACCCTGTCAATGACTTTAGCCCGTACAACCCAATGTGCGTCGCGTACGCATCGTAACGCGCGAACTCACGGTTGTTTGCGGTCGTGTTCATG
CTAATGCGATAAAGCAGGATGCTCGCGCCGCCTGAGTCGAATGGCGGCGACCATGTGAAATTGGCACCGCCTCCAGTATACCATGAAATTTGTGCGCCAA
TTGGCATCGTCGGTGGCGTTGGTGCTCCCAATCGCATTAAAACAGGTGCCGACAAGTAGCTTTCATAAATTCGATTCGTTGCTGCAATAGAGACCCCAAC
TGTCGATTTTGCTGCCAGATTTGTAATCGTCAGTGAGACATTGGAGGTTGTATATGTTTGCGTTGCTAGAACGTCTGAGGTTACGACAACGCGGTATGTG
AGGAATGTCACGTTTGCTGCACCTGTGCTCTCAGGAGCGGTCCACGTCACATTGACACAACCACCAGAAATGGCCGCAATCTTGACGCTTGTTGGCTCCC
ACGGTGGGGAAACGTCGCCGTCATCCAAAATCTGGACGAACACTGGTGTATTCCTCGTACCGAGTCGTGCTCGACCACTTGTGATCGTGAGGTTGAGGCC
GAAGAACTTGCGGATTTGATACTCGTTGTCGTTGACAATTGTAATACGAACTGATACGACGGTCGCCATATCTGCAAACGTCACGACCGATGTCTCAAGC
GAGTAGTCAACGTTTTGAACCGCACCACCAAGAACATCAAATACGTCAACTTGCGCAACCACTGGTCCGCTGAACGCATTGACGCGGACAACTGAGACAA
TGAGACTGGATAAAGATTCATGGACAGAATACGATGGCTGCGAAAACTGAAGCGCTCCACTATCGCCATCGTCTTGAATTGTGATGCGAGCTTGACTTGG
TGAGCCAATTGCACCGGATGCGAAGCTAACCTCAATCAGCTCAACATAGAAAAATCTGTCGGGGTCGTCGATGACAGCGTTATTGATGATGTCAACGGTG
ATCGTTTGCATTTTCACACCGACGTCAAAGTATATCGACCCTGTAGCATTTCGATAATGAACTCCAGCACGAGCTGTTCCATCCAGAGTACGAAAATCGC
AAGTCGCTGGAATGGCACCACCGCGTGTCCGCGTCACATTAACTACCACGCTTGCTTGATCTTCCGAGACACTCACGGCATCGAACAGAAAGCTAATTGT
CCCAGGAGACACAGGATCTGTTTTTGCGGCGACTGGGTCGCTCCAATCGCCAATNNNNNNNNNNNNNNNNNNNNN