Description :
From Genome Similarity Track
Location :
Scaffold_4:289608- 296573
Transcript NameFunction/comments
Physo_368696predicted protein

Sequence
6965 bases(100 bases per row)
AAGCCCTGTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACT
AAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGAACTCTAGAAGCGGAGAAGGGCAGCGGTGGGCTGCTT
GTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCA
ATCGCGACAAGTACGCCGATGCGCTACGAGGCAGAAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCA
CATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTTCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTG
GAGAAACACGAGTCTTGGATCGACTGGCGCGGCAAGGCCAGCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTCAGTCATGTTCCCACCTCTG
CCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCATCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCTGGCCGGACA
AGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAG
GCGCCGCTGGTGTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGAAACTGATGCGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATA
GTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAG
TTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGGCGAGTAACCAAGTTCCGCTCAAGGACAAGGTGGGTAACGTAGTTCCGCACGAGAT
CGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTC
GCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCG
AGCTTACAGCTCTGCCCGAGGTTTCGGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTT
GGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGC
ATGGGCTCTGAGATTCTTAAGAACCCCCAGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTC
CGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGCGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGA
TGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGAAAAGTGG
CGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGACCGGCTGCA
CGCTGTAAAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCT
CTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTTCGACCTTTGCGTGCGTTCACACAG
ACGTACTTTGACGGCATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTTGACGTGTGTTCGAAGTCATGC
GGGCCAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTTGCAGCTGAGGAGATCAAAGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGACCCGGAGAA
GGTAAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTAC
GCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCT
TACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGC
CGACGATGAAGGCCGCGAACGGGCCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATG
AAGTACGCTCTTGTTAAGTTTCGAGTGCGCCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGC
ATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAACCGGGCAAGTTGAACGTGCTTGCCGACGCGCT
GTCGCGCCGACCCGACTACAAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGAA
CCTCTTGTGCGGTTCTTGGGCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTT
TGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCC
ATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACTTCCGTACG
TGCGAGAGGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACT
TTGGCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGCGTTGTTGCCTTCGTGTGCCGCCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACAC
CGTCACTGGCGACGAGGTCGCTCGTCTGTTCATGGACTGTGTCTTCCGACACCACGGGCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACC
GCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATC
GCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCACTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACA
TGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTCCCGGGGCTTCGGGCCTAAGTGGG
GGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGGCAGGCTGAACATAA
TCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACTGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGA
TTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTC
AGCCGGCATGGCGAGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGG
CTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGTCGTCGAGTCGCGGTAAGGTGCCTGATACGCGCGC
TGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCGCTGACCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCT
CCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCAAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCC
ATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAAG
CCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACG
GCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGACCCTCCTTGATCGTAATGGGCAGATCCACCACCACGTGGAACGAGTCGTCC
GGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTGCCCGAAGG
CTGTTGCGATTTGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGC
CCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGA
GCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCATCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAG
GTCTTCCACCACGCACCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTTCTCCGGCTTCTTGCGAAGC
GTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCAC
GCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGAGCAGGAA
GTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTAT
TGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGG
AGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGTCCTCGGCGGCGTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTG
TCTCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTAGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACT
TCGTCGTGCGACTGCTTGCTCTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACAAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGC
CTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTC
AAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGTCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTTCTCCGAGCCCCGGCC
TGACGGCCACTCTTCGGCGTGCTGCTACGAGAGCTCACCACCTCCTTGGCCGCCTTCGTGGCCTCCATCAGCACGGACGACTCGTCCTTGGCCTTGGCCG
CCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCG
GCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTG
AGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGATCCTGTCACTATTCC
GGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTT
GTATGCAGGCCAAATCTGTACCAACCTATAACTGCATTCAGTCTTAGATCGCCCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAGCG
GCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA