Description :
From Genome Similarity Track
Location :
Scaffold_338:28955- 30805
Transcript NameFunction/comments
Phyta_totarag7291hypothetical protein

Sequence
1850 bases(100 bases per row)
AGAGTCGAGTTTGGTTGGGAAGTACAAGTAGCTGGTTTGTTGCGGGAAGTGTATTGGCCCATACAACAATCAAGTCAGAATCCACCCAAGACACACGTGT
CAATTGCCGTAGTTATCTACTTGGCCGGAAAACTCGACGTCGCTCTCAAATACCCCCAAGATCCCGCTATAGGAAGCGGCAAGTAAGTACGGAAATGAAA
AGGCAAGGTTCAACACGCACCCAACAAGGCAACCCCCGCGGCAAAGATCAAGCCGCCGGATCCAAGCCTCTACAAGTTTGCAAAGCAAGGACAACAACCC
GGAACCTGTGTGAAGATTGCCACGCAGGATCCAATCCCGCCAAAACATTCCAAGCTCACACCCAGCACATCCTCGTGTCAACGAGAGAGCAGATCGTGCC
AGCCGACGGGTAGCATCAGCAACCCCACGGttatcggagtaccccccGCCGTTAGTCGCCGTCGGGGCACAAGTGTGCGGGTGAGAACAGAATTTTGTTT
TATCCCACTACTCCACAATGGTGCCCGTGATTTCACCGTGAGTCCAAAGAAGATGTGCTTGCGAACAAGGAATCGGGAGATGAGGCGTCGATGAAATTTG
GAtcgccgacgacgtcgctaAAAGCAAGATCCACGGGTCGACAGAGCCCTGGGAGAAGTGATGTCGACGAGATCCGGACCTGGATCTCGAAGAAAACCCT
CATCCTCCTCCACAGGTCCCTTCGGGACCCCCGCGGATCTTGATGCGAATCGGGATCCGCCGGACGAAGATCCATCAGTGAAAATGGAAGGGTCTTCATC
CACCATCTCTCCGCCGGCCATCAAGACTGCgtcaaggaagaagaacatgacgAGCAAGGCCGCGTGGTAGAAACTCAAGGCACCAGAGTCGGAAGGTGAA
GACCGTGATGAATTGAAGCTTACTTGGGCCAAAACCCAACCGGAGGATGTCTACCACCGGAAGGAGCTGAACTAGTTCTTGGACCGTGATAGAGACCCTG
TCGTGGCAGCTGCTTGGCAATCTGAAGGGACCCGTGACTGCTCCACCGGCGACTACGAACAAGCTGGCCGCAGTGAAGATCTTGCTGATGGAAGTTGGCA
TCGTTGCTAGGACGTTCGACGCGAACGACCTCTTCAATCTGGACTTGGGCGTGATCAAGACTATCGTTGTGGGTCTCTTcgggaagctgaagatccTTGT
GGGCGAGACACCTCGCACTGACGATCGCCAGCCGGCTTCCCAGATCCGAACCCCGGAGTACCAGACTGGATCCTCCCACTATGCCTCGGCGACGTCAGAG
GTAGACTCGGACAGCTCCAGTAGTCTGCAGCGCATGTCGCGTGGTCCCTCGGGTGAAGCGATGCTGCGATCCCGTACGGCCCTCCCGGTCACAGGTCCGG
AGAAGCCACGTCTTGCAGTCGCTTAATCCCCAGTCGCGGATCCCCCGCACGACTCGACAGACAGACTGAAGACGTACTTCCAGTCTGTCATGAACCGGTT
CTTGCGTGAGCAACAGGCATCAGCCACCCCACGAGTCATCACCCCGGCGAGATCGCCTGGATCCCAGGACGTCGAGATAGAGTCGGTCGGGACCCCGGAT
CTTCAACGCTTGGAGTACGATCCCGACGACCATGAAATCTCAGACACCCGACGCCCGGTCGTGGCAACAGCTACAGTTGGCTCGATCGGATCCTTCATGG
TCCAGCGAATCCGGATCTCAGCAATCTCCGACTTGAAGGAGTTCACGGGCAAGGATCACAACGAAGAGCGAGCCCGAGCTTAGCTCAGCAAGGTTAAGTC
GGCGTTCCAGCGCGACCAAGCTTCGGACGAAGAGAAGTGTTTGGCCTTCG