Description :
From Genome Similarity Track
Location :
contig_54:289541- 290916
Transcript NameFunction/comments
g11294.t1hypothetical protein

Sequence
1375 bases(100 bases per row)
CTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCA
CGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGC
ACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTC
GACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTCCAACGACTCTCGCAGT
CGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGG
CCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCA
ACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGT
TCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAG
TTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGC
AGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGG
TCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGA
TGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGAC
GGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCT
CGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGA