Description :
From Genome Similarity Track
Location :
scaffold_180:28953- 31968
Transcript NameFunction/comments
Pl_108171conserved hypothetical protein
Pl_108172hypothetical protein PHYSODRAFT_484729
Pl_108173hypothetical protein PHYSODRAFT_326676

Sequence
3015 bases(100 bases per row)
GCCATGAGCCAGCGCGAGTGGATGGAGACGCCCAGCGTCGTACTCGACGAGAAGCGTTTGCTGCACAACATCGAGCGGATGCAGGCGCTTGCCACGACCA
ATAACGTGAACCTCCGTCCCCACGCCAAGACGCACAAGACGCGGGAGATCGCGATGATGCAGTTGGCAGCTGGAGCTTGTGGTCTCACAGTCTCCAAACC
GTCTGAGGCGCTGCAGTTCTTGCGGGGAGAAGTAACAGGTCTCAAGAGTTTGACGCTGGCGTACCCAGTGGTGCAGAGTAACAAGGTGGAAGAGGTACTC
AAGGTGGCACAGGAGGTCGGTGTGGAGTTTCTATTGACTGTGGACAGTTCGGAAGGAGTTGATGCCGCGCAGAAGGCGGCAGAAGCTTGTGGCTTCATCG
CAAAGCTGCTGATCCATGTTGATGTGGGATACCACCGAGTGGGTATTGAAGAAGACGATTCGAGGCTGCTGCAACTGGCGCAGAGGATTGACACGACGAG
CAGTCTTGAGTTTCGCGGACTTCTGTCCCATGCTGGACATGCTTACCGCTGCAAGTCGGTAGCGGAGTGCTCAGAGGTGGCGGAGACAGAGAGACAGATT
ATGGTCCGCATCAAAGCCACGCTGGAGGAGAATGGAATCGCTGTTCCGATCGTGTCTGTGGGTAGCACCTTGACCGAACCTGTTCGTAAGAGCTTCGCGG
GGATTACTGAGATTCGTCCTGGAAACTACGTATTCCTTGATCGCACACCCGTACGTATGGGGTTGTTCTCGGTGCAAGATGTGGCGTTGACTGTTCTTGC
GACTGTCGTTAGTTCGAACAAGTACAACTTCATCGTTGACGCAGGATCGAAGGTGCTAAGCTCGGATGTAGCGCGATCGGCTGGTGAGTTCGGCTCATCG
TGCTACGGTCTTGCATTTTACGAAAAGGATTTCGAGCGTGTGGTGAAAGAACCTTCTCAGCACAAGACCCTACTCGATGATGGCCATGAGCTGGTCTGCT
TTGAGGTCACCAGCCTGTCAGAAGAACATGGTTGGGTGAAGAAGGTCGATGGCATTCCTTCTCCCGCCATTGGTGAACGCCTCGTCATTGTGCCTAATCA
CGCCTGCGTCGTGTCAAACCTCACCAATAAATTCTACGTGCAGGGCAAGGAGCCAAAGAGCTGGACGCTGCTGTCCCGTGGATGCACTCAGTAGTAGCAC
CCTCGCTAGACGGGAATTCGTCTTAGGTATGGTCTCGTTTACAGATCACAAAAGCGAATTTGTCGGTAGCTCCATTAAAACCATTGCAACTGAAGGTTTT
GAACAAATTGGCGGTTGGCGTTGTCCTCTATCCGTTGCATCAGCTCCTCCTTCGTTTGCGGCAGGCTACTGTTCGCACCGCCATCCTTAGCTCTGAAATT
CCCCAGCATTTGGGTTGTAGCAGCCTCGATCACTTGCAATTCATGGTGATGTGTCGTCATGTAGTGGTCAAACGCTTCCGTTTGAAGATGAGATTCATGG
AGCGACTGTGCCCACTCTTGCTCATAGACTAATTTCACGAGGTGTCTGCGAAATGAAGAACGCAGTATCTTGGTGACCATGGACCTGAACGCTGCGTTCT
CGGCGTCTAATGCTGGCTCCACTGCATCCGCGAGACTCTGATAGTAGGTGTTGCTTTCAGCTTTTGTAGTAGTCTGCGGTGAATGGTACATCCATGTTGT
GAGAGCATATCTTGGCTTAGTTGCTGGTATGACACGGTGTAGCATTTGCTGGGACGAGAAAAGCACCAATTCACCGAAGCGTGGCTGCACAACGACCCGT
GACTTCGGGAACGGATAGAGTACAATTTCGCCTCCATCCCCCTTCGTCCACTCTTCATTCAGGTAAAGCACAGCAGTCACGCATTTCCCGTCGTCACCAT
AGGTATCAAAGTGCATCGGGAAGCACGCTCCACGCCCAGCGTTATGCTGCACCTTGACCATGTGTCCTGTCACCCCCAACCAGTCAGGCAACGCTTGCCG
TAGCGGACTGAATACCACTTGATGCTCAAAGAAATCTCGCAGGAACGGCACGGATGTTTGGTCACGAATTGCATCTAACGCCAACTCTGTCTCTAGGATG
TCGTGTTTCTCCAACAACAGCGTTCTAGTCGTCGATTTGCTCCCAGTACCAGATTCACCTCCTCCAGCCGCATCATTCAACACGATATGCGTTGAATTCG
GGTACAATTGGCCACTTGTGCACAGCCACTTCATTTCGTCGCGCAAATGACGTAGATACTCGACTGGGAAGGCGTTCGGAACTACATAGTAGCCATCTCG
CAGGAGTCCGTTCGCCAATTCAGACGTCACAGATAGATCCCAATTTGCGCCGACCCGGACTTGAGCTGGGGCGATCGATGAGAACAGGGAACGCGCGCCT
AGACAACGGCGCAGCGGCGACCTTGACACCCTCAGCATTTTTCCTTTTGTTTGGCATACTATGCGATAGTGTAGTGCGCAGTCAGACACATCCAGGACGA
TGGCGGAGTTCGTGCCGAGCGGAGTGATCGAGAAGGCATCGCTCCACGATATGATGTATTATTACGATGTTGCGCGTGTGTATTGCAGATACATGCACGA
GGATTAAATGTTGTCATTTGTATGCAGCTATGCCGCTTGTCCACGATGTTTCACCTCCATGACTTCCCAATTGGCTTCCAATGCAGGCATGGAGCTGTTG
CGTGTGCAATGCTCGTCCTGCAGTACTTACAGTAATGTAGACCAGTTGCAAATTAAGTACCGACTGAAGGTGAGTACGGACACCTCGATGTTGAAGTGCC
TCGTGTGATTGATCGACTCATTTACAATTTTTTTGTTCCCGCTCTCAGCTACAACTTTTGTACGGATCGACTGTAGCCGACGCTATGTTGTTTGACGAGG
TAGCGGAATCACTGCTCGGTGTCCCAGCCTCCAAGATGAAAAGCGAGATTCTCCCCAAATATCCGAGCCTGCCTCATGTGCTGGAAGAACTGCTGGTCGG
ACTACGCGTGTCCTT