Description :
From Genome Similarity Track
Location :
Scaffold_26:289446- 292915
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009464Similar to CRY2: Cryptochrome-2 (Gallus gallus)

Sequence
3469 bases(100 bases per row)
TGCTGCTGCTACTTGTCGTAGTAGGACCAGAAGTTGTGGCATCAACTGAATCTCCACGCCTGGAGTCTTCACTCTGAAGTGACGACGAGCCACCGCTGGG
CGTACTATCCGTCGTCCTTTGTGGCGTGAAATCTGGTGTGGCCGTCGTCGTTGGTTGTGACGGTGGATCTGGCGTGGCTGGCGTGGTTGAGTTCGCCAAA
GTTGCAGTCGCAATGCCATTAGGATCATGGCCTGGCGCTCCGACGGACGGTGGATCCACAGCTGTCGTCGCGTTGCTTCCATTACCATTGCTCGAGGCAA
TAGCTGTCGAGTTCAGATTGCTTGCGCCATCTGACACGACTGCCGGGTCATTTGCATTCGGTGCAATACTATTCGTATCAGTAGAAGGTACTAACGTCAT
CGTATTAGCAGGTTCTGTTGTTGGTGCTTCTGTAGCTGGCGCAGGCGACGGTGTTTCAGCTGGCGCCGTTGTCGTCGTTGGTGCTTGGCTTGGCGCTGTC
GTAATCCCAGCAGCAGTAGTAGCAGCAGTCGTCCCCAGTCCCGGTTCACCTCTACCAACTGCTGGCGGGAGGAAGCCGCCGGGACCGCCATTGCCAAACC
ACTGGTTGTTGGTCGTCGGCACCTCGGCCCCCATTGCATTCGACGCATTCGTTGCCTGGGCCTCAGGTGTCGCAAAGGTGACGCTACCAATGTGGATGTT
GACGATCACGTTGCCGGTGTTCTTGCTGCCAATGCGCGTCACCAGGCTGTTGTTGGCCGTCCACTCGTACTTGCAGTCATTGTTGTCGTCCTTCTTCTTT
TTGTGCATCTGTTGCTTCCTGTAAGCGCTCTCGTGCTTCTTGTACTTGTGCTTCTTCTTCTTGTCGTCTTTCTCCTTCTTGCAAGGATCGGAATCCGAGT
CCGAGTCATCGGAATCGTAATCTTTGTAGTCGTCATCCGAGTCGGGATCGTAATCATCCTTGTAGCCTTCTTCACCCGCATTCATGGTCGCTGACGGCTT
CTTCGGTTCCATTTTCATCATCGTCCCATCTTCACCTTGGGGTTCATCGTAATCGCGAAACGCGTGAACCTGTCCATTTGGAGTTCCAGCGCGGTCTCTT
GCTTGCATATCTTCTGAGCTTCTTGATGGCGGCGGTGGCGGCTGGAACGCATTGGGATCTTGGCGCTTGTTGTATCGCTCTGATTCAAAGCGATCTCCTT
GACCATGCTTGATTCCAAATGGCGACATACGTAAAGCGCGATGAATCGCAGGAGTGTCACGAGTACGCAGCAACTGCGTTACAGTCTGTGCGTGTGACGA
TGACGATGCAAGAAAGTGCCACAATGCAGGCGCAAGCGCGGCAAGCAGCAACAGCAGAAGCTTCAATCGTGAACAGCACGGCATTCCGTTGGACCCGATG
CGTGCGGGTAAGCAGTTGGCGAAGTGCATGGAGCTGAGGCGAAAGCGGCAAGTGAGTCTGCAATCCTCACTTCCTGCCATGCAAATGTCCCATCAAACAT
ATCAACGATCAAATCAATCAGTGAGTGAGGTGTGGTGATGGGGACATGAATGGAGACGCAGAGCAACGCATGCTATCAAATAATGTACCAATGTGGGGCT
TCTCCGTCGTGACGTGTCTTCTCAAAACTGCTCGTCGTGTTTTATTGTACGTCTGCTGTCTTCTGTCTGCTATCTGTGTGGTTTTTGTGCTGGAAGTCGG
GGACGCTAATACACGGAAGTCGAGTCCTCGGACTCATCCGAGTCCTGGCGCGCGCGCTTCCCATGGGGGCTGCGCAGGTTCTCATCGGGTGAAGTGCCGT
AGATCCGCTGCGCGTACGACGCCTTCATGCCTGCCATACACCGCTTCAGCGCGATCTTGTGGTCGACGATCGGAAACGGGTAGTCCTTCCCAATCAGACA
GTCCGCGGCGCGCTGCACAGTCATCGGCGCCTTCCACGGCTCGTAAATGTACTTGACAGGCATCTTCTTCAGCTGCGGGATGTACTTACGGATGAACTTG
CCCTCGGGATCCCATTTCTTGCCGAACGTCGACGGCGAGTAGACGCGAAAGTACGCCGAGAAGAACGCGCTGCTGCTGAGCCAGAGCCAATTGCCCGCGT
TGATGCACCAGTCGTGGTCAATGAGCCGCTCTTGAAACACCTCGAGGCCTCGGACCCACGAAATGTAGAGATCCCCGCGCGTGAGGAAACACGCGACCGA
GTGCCGCGCCAAGTGGTGCATCCAGCCTTCCTGCTTCAGTTGAAGCATGATCGCATCAATCCACGGGTACCCAGTCTGCCCTTCTTTCCAGGCTTCAAAT
TGTGTGCGCGCAAGTTTGTCGTCCTCGGTCATGTCAGCTTCAGAGTTCGGGAGCGTGTGCCATCGCCAGTCAATCTGGAGGCAGATCGGGTTCTCTTCCA
TCTTGTCAAAGTACGGGTTGGAGCGGCCGCTGCAGTGGAAGAACTCGCGCCAGAGCAGTTGGCCGTCAAGACTCACAGGCGGGGCTGACGACGCCAGCTT
GTGGCGCTCCTGGATCTCGCGCACGCGGTGGTAGAACTTTCGTGGACTCAAGCAGCCAAAGTACAAGTACGGGCTCAGCGACGTCGTCGACGACGACGGC
CTCGTCTCGGCCGGCGACGTCTTGGGCTTCTCGAACTTGACGACGCGGCCCTCGTTCTTGCAGTACTCGTTGAGGATGTTGAGTGCGATGGCTTCGCCAC
CATAAATAAACGAATGCTGTTCGATCTGCTCGTATCCGAACTCGGTAACCTCGGGGATCGTGAACTGCTGCTCGGGACCGGCCATGAGCTCGATCTGCGC
GCGAAACTCGGCGTCGACCGCGCTCTGCCGCTCGGGCGCGAGCCAATAATCGAGCACTTGCTGGTACAGTTCGCTGGGCAGGAACTCGGGCTTTGGCAGA
TGCTCAGGCGTCGCAATCAGCTTGGACGGGAGCGGGAACGTCGAGATTGCCTTGAGAAACGACGTGTACGTCTTGGGTGCGCGGCCGTTGTGGCGGTCGA
TCACGGCCTGCAGGTCGTACAGCGTGCAGCCGAATGTCGTCTCGACCACGACGTTCTGAGAAGCTGCAAACGCCTTGACGCGGTCGTCGCGCGCGATTGC
AAACGGTTCGCTCACTTCGTCAAAGAACAAATGCGTGATGCCCCATGCCAGGATCACCTTTTGCAGCACCTCGACCGAGTCGCCGCGCGCGATGATGAGT
CGCGAATCGCGCGCCGCGATGGCCTCGGAGAGCCCCGACACGCTCTCAATCATGAACTGGAAGCGGTTGACGCCGCAGAGCATGATCTTGGGGCGGTGCA
TGATGTAGAGCGGAATGAGCTTCATGCCCGTGGGCGCCGCGGCCTGCAGCGCCGCGTGCAGTGCCAGGTTGTCGTGTATGCGCAGGTCACGGCGGAACCA
CACGAGCCCGCGCAGTGGCTTTACAATCTTGTCGGCCGTCAGCGTCGGCATTGTTGCTGCTGGGTCCAG