Description :
From Genome Similarity Track
Location :
contig_6:289432- 291405
Sequence
1973 bases(100 bases per row)
CATCATGCTGCACCAAGCAGACCACTGCTCCCACGCTCGTGCATAGTATTTTCTGGACGATTGGGCTAAAGCCCTTGCTCCCCAAAGATTTGAGAGATCG
CGCAAGTCGTCCGGGATCTGAACCTGTTTCCAATCAGAGCTCAAGTTAGCAAACATAATGGCCAAAGATGGCGACCGCCACGCCCTGCTGCATGCGCCTG
CCATGATATTGTCCACACCGGCTATGTGAGAGGCTGATGTATAGAACCCGTACTGGACTTCGCATATGGAGAGAATGCGAAGCAGCATTTGAGCGATACT
ATTTCGACGTGACTTGCGGTTGCTCCAAGCCACAGCCGAAGTGTTATCAATCCAAAATTTTACATGGGAATCGCTTTTAACACCGGGACTCTTCCACACA
GGCCCCCATACCAGAGACGCAAAACCCGCACTCATCAACTCCCGTACGTTGATGCAGAATGTGCTATCGCCGGTCTCATTGCAGAAATTAATGAGCCGCG
TTTCTTCCACCGTAAATTTTACTTGCAGGAACTCTCTTCGTGCCGGAAACAAGGCGCATAGCCCTTGGTCACTGGCGTTCATTTGGATGTGGTAGTCAGG
AGCGTGGCGACACGTGAAACGAGACAGAGGAATTGCATTCAATCTTCCAATTCGAATAATGATCTCGAACCACCGGAGATCATCTTTTGTCCTCGGAGAC
AACTACATATCCGAACCGTGGTGCGCTGCGTGCTAGAGCTGCAACCCGTTGGAAAATGGGTGCTGCCGGCCTGATGCATGTAACCACGTGACGAAGACTG
CCCAGAAGCTTCTGTAATTCGGTTCGTGTTGTTTTCGTTCTGGCGCCCATGATATGAAGGTGCTCTAGTGCTTTTGTCACTTTTTCCGGTGGCATCGAGA
CATTTTGAGCAGCTAGAACCCAGTCGAGGCCCAAAGCGCGACCGGTTTTGAACCATCTTGTAAATTTCTTCTCGTTGGATGCCTCAGGTCCACGTATAGT
GATCGTTGCTGACCGGAGTGCAAGTTCAGCCTCGCTTAGCCGGATCCAATATCGGGCTCATAGCGATGTGGTCATCGCACCACGTCTTCGCATCGAAGTT
TGCCTTTGCTTAAGCGGGTTGCAGCGGCCAAGAAGGGGCTGGACTAGCGTATAAATGTCCGATAGCTCCACCCGCAACCCAGTATGATGACGGCGAATTC
TTCCAGCCGAATGGACAACATAGATCGATGACCAGCACTCCAAGCTCGGGAATGGTTCCGGAAAACCGCCCAACATGATCAGCTGACATGGGAATATTGC
GAAACGCTCCGTTCACGTCCCCGGTCAACATTCGCTGTAACGCAGGAAATACATCCGCAACGTTAATTATTCGGTTAGCCAAGGCGTCAGGGCCATCGTA
GCTCACGTTCACCTCATGATCCGGCCCCGTGTTGTCATTCACAGACTCACCAGGAGGGAAGGAAAGGTCATGGATGATTCGAGCATCGACACAGAGATCC
ACATCGCCTTTTTGTACTGCTCCGAACGGACTGCACGTGACGTCCCGTAACAGCGAGAGCAGATCAATGTCCAAGATGATATAGCGATTCGAGTCCTGGC
CCGCACGAAGATGCTTGACAATGATGTTGAGGGCGCGATTATCTGAGCCGTGGTTCGCTGGCACTGATGACTGTGGCTTGAACGGCGTTTTCCATGCTGG
AATAACGCCGTGACACACGATACGTTCCCACTGGGGTCGATATCTGTAATTTTTCCAGGTGGGCTTATTGAAAGGTTCTTCCAGAGACTTGTTCGGACGG
GGGTCAAGGACGGACTCACCTCGTAGTATGCGGACAAATTCCGGCAACGACATTCCCGTGCGGCGAATAAACTCACTGTATACGGTTTGCTTCGGTCGGT
CTAGCAGATATGACACTCGACCGTTCTCCGTGACCGAACTTGGTGTGCGTGTCGGGGTTACCAGTCCTTGTTG