Description :
From Genome Similarity Track
Location :
Scaffold_1951:2894- 4969
Transcript NameFunction/comments
Phypl_g14445hypothetical protein PHYSODRAFT_249657

Sequence
2075 bases(100 bases per row)
TGAGAAAGAGAGCACACCAACCACTCGACTTCACGTGCCTTACCCTCCAGGCAGTGGTACTCGCACTCGTCCGTCTGTATCAGACCCGTTACCGTCTGCT
GGAGGTCGACGTCAATCAAATTGATACTTAgatcctcttcctcctcgtcggcgctgtcgccACTCTCAGCCGTCAGCACTGCCACATCGCCATCTGATGA
CTGTTCTTCACTCCaatcctcgtcgtcactgtcgtcTGCCTTCTCGCTTCCACCAGAGCCTTCGTCCGAGGCAATTACCGCTCTCGCAGCGACGggaggc
ggtggcgacaGGCTGCTATCATGCGCTGTTGAATGCTCGGCTTCGGTCTCAGTAGAGGAGACGTGGGGGGGCCACCGCCTCCAAGCTGTTGGGGGTGGTA
GCGCGCTGATCAGAGGttggtgctgacgctggcgttagcgaacgcggcggcgaggtTGTGCTGGCTTCGATAGCTTCCATTGTGGTGGGGGCGTGAGTGT
GCTCGGGGCTGTTCAGATTAGTGACTGCTTGGATTTTCAAAAACACAAATGCGGCCGTTTCTCAAAACTTCGACTAAATCCGATTATCGTTGGTCCAACT
TCGAGGTCGATTATCTCAGTAACTCTAAAATGTGGATTAGTAGCATTATGTCAGCCGCAGTCTCGTATCAGAAACTCGGTATGCCgggtatgctggtttt
ggagAAAAACTCGTCaggtatgctggttttggagtTTTCTCGATACGGATCGGTTGTATTATAgtactactgtagtagtaTTATAGTGAGAGGCTCGAAG
CCGAGCAGCAATGGGAAAAGCGAAGCGAGGACAAGTAtaatatatatatatatatatatttttTTTGGTAAGGTAAGGTTGATTGTGTTACTTGTCTCCT
AATGGGTTGAGCTCTATAGAGTATAATATATATTATAGTACTTCCTCTGGTTGGAAATCATCACCGGGAGTTACTATGACAGGTCAGAGTTTTTTCTCCT
AGTATTTAAGTATAGAGAGCTGCGCATATTGATTTGCAGAATGTTTTGCACGACTACCATTGTGAAGCGCTTGCTCTTCCAGGCTCCTGAAGAAAGCTTT
CTTGCGCCTCGTGCCGCTGTTCGGCTTGATGCGGATGGCCCACCACCATCAGGGACACTCAACTCGATGGCGGTGGGGTAGCGCTTCCAAATAGTGTTCC
CAGTTGTCGGGTCACGCCCTACTTGAGAACCACTTGAGAATACGCTCTTCGGGACAATTCTCAGTTACTGCTGTGCTTTAGAAGCTCGTCAATGATGGTT
TTGCGCTCTCTAACCGATAGGTTAGTCTTGGGCGTGTTTCCATGGCCAGGCACGAGCTTGTGCAAGCGTGGCGGGTGACCCCTCGAATATTGCAGGTGAC
TTGGGCTGCTAAAACTGAAATGACTGAGGGGTGGCAATCGAAAGCAGAGATGTAGGGCTATCTTTTAGTCCAATCAGAAACCCTTGGTAAGGCCTAGGTG
TGGAGTTATTGGTCAAAACGTCTGTTTCCGGTGATCATTTCCAACCAGAGGaaatactacatgtacggtACTACAATTGCAAGTTTGGATGTATTACAGA
GTATCAGTTATCTAGTGCCTCCAGCTTCGGTGAGAGATTATTTTTCTGGTTGCGATGGGGAGTGTAGTCTAGCTGAGCAGGTGGCAATCTACTGGCAGGA
CTCGCCCTCGGCGTTGGCGAAGTCGAGCACCCAGTAGTGCTTGTAcgtcttggtcttgtcgTAGGCGTAGCCAGGGCCAATGAACTTGAAGTCGCTGTAC
AGGTACGCGCTCGACGACTTGACCCACGTGGCGATAACAGCGTCGGCACTGGCCTGGCCGGCAGCGACCAGCTCGGCCGATTGCGCGGTCTCGATGCCCT
GGGCGTCATAGCGCGTGTTCGGGGTCGAACCATCCGAGCCCTTGGTGCTGACcttgttgttcttggcgtTGTCGTCCGCGAGGGTCTGCGCGGCCTTCGC
CAGCTTGGTGTTGacgcagacggcggcgagtcCCTTCGCCGAGCGCTTGGCGTTCACGGCGCTGAGTAGCTTGGC