Description :
From Genome Similarity Track
Location :
Scaffold_1923:2894- 4436
Transcript NameFunction/comments
Phyag_g11750putative copper-transporting ATPase

Sequence
1542 bases(100 bases per row)
AGAGCGAGTCGTACCGATTGAGCTGGTCCAGCGAGGCGACATCTTGAAGGTCGTTCGTGGGTCGTCGATTCCAGCGGATGGTGTCATCGTGTACGGCGAA
GGGCGCATTGATGAGTCGATGCTGACCGGTGAGTCCAAGACAATCAAGAAAGTTTCAGGCGACCGCGTGCTCGGAGCAACGGTGAATGTGGACGGGTTGT
TCCACATGAAGGTTACTGACGTGGATAACGATACTGCGCTGAGCCAGATTATTCGTCTCGTGGAGGATGCACAGACCTCAAAAGCACCGATTCAAGCTTA
TGCAGACTATGTTGCCTCCATCTTTGTCCCGACGGTGTTGGGGTTGTCGCTCCTGACGTTCTCGGCTTGGTACATCCTTTGCATTTTTGAGGTTGTCCCG
GAAAATTTGATCCCGCACACGGACAGCACTTTCGTGTTTGCATTTAACTTTGGCATTGCCACCCTCGTCGTGGCTTGTCCCTGTGCGCTAGGATTGGCGA
CGCCGACGGCAGTCATGGTCGGAactggagttggtgctgagCACGGTGTTTTAATCAAGGGTGGCGAGCCGCTGCAAGCTGCGCACAATGTCAACACGAT
TTTATTTGACAAGACGGGAACCCTGACGGTTGGAAAACCAGTGGTgacggacgtggtggtgcttaGTAAGAAGCTGAGCACCGAGGAGCTGATCATTCTT
GCTGGATCGGCAGAACTAGGCAGTGAGCACCCGTTGAGTAAGGCGATCATCGAGTATGCAAAGTTCATCTCATCATCTCTTGAGCAGCCGACAGGTTTCC
GCGGGGTGTCTGGACGAGGCATTGTGTGCATGGTCGGAGAACACAAGATCGTCATAGGCAACAGGGAGTGGATGGCAGACAATGGCCTCAAGCGTATGAC
GAGTATTGTACTGCAGCAGGCCACGCTGACGTTCCAAAATGCCGGAAAGACGACAATCTATATGGGCGTTGACGATGAACTCAGCGCTGTCTTCGGTGTG
GCGGACGCTCCACGCAAAGAGTCGATCCGtacgctgaagaagctgaagcagatggGTCTGGAGGTCTGGATGGTCACCGGTGATAACGCGCGTACTGCAT
TCACCATCGCTGACCAGCTCGGGATCAGCCGCCGCAACGTCATGGCCGAGGTGGTTCCGTCCCAGAAGTCTTCGAAggtcaagcagctccaaagctCCGG
CCGTATTGTTGCCATGGTGGGCGACGGCATCAACGATTCACCTGCCCTTGCGCAAGCGGATCTGGGCATCGCCATTGGCGGCGGCACCGAGATCGCCGTG
GAAACGGCCGGCATGGTGCTCATAAAGGCCAACCTGTTCGATGTCATCACGGCACTGGACTTGTCCCGGACGATCTTCAACCGCATCCGACTCAACTACG
TGTGGGCGCTTGGCTACAACTGTCTGCTGATTCCGTTGGCTGCCGGTGTGCTGTATCCCTTCGGCTTCAGCATCCCGCCCATgttcgctggtggtgccat
GGCCATGTCGTCCGTGTCGGTGGTCACCTCCTCGCTCTTGCT