Description :
From Genome Similarity Track
Location :
Scaffold_53:289398- 290597
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16110ATP-binding Cassette (ABC) superfamily

Sequence
1199 bases(100 bases per row)
ATGCAAGTTGCAATTATCAAAACCCTTTTCAAGCTAGGTAGTGCACTACGTCGAAATACATTGCGAACCTTTAGCTATGGTTAATCACAGCCCAGGGTGC
AATCCGAGGACTCCTGGGCTTGGTTCGCCGTGGACCTCGCCGAAGTACAGCGCAAACGTCTGCTTCCACTGCTCCACCTTGGCGCGATCTTCCATGAACA
AGGGGAAGGCAGCCATGTTGGCCTCCGGAATCTCCCAGGGATTAGCCATGTTGATGTCCGTGCGCACGCTAGAGGACACCAGCGACGTCTGGACCTCCTC
GGAGATAATCCAGTTCATGAACAACTTGGCAGCAGCAGGGTGCTTAGCTTTCGATAAGATGCCCACACGCTGTCCCCAGCTGAGGTACTCGGTGCCGTTG
CCGTTCACGAACTTAATCGGCTCACCACCACCGCTTGTACCCACCCCAATAAGCTTCTCCCCCGAAGTCACAAGTTCGCCCGCCACATTTGTACCGCGGT
TAAAGCTGGCATTCTGCTGGGCCATTTGGGTGGCCCAGTACCAACCATATTTCTCCACGTACCGAGTGAACAGGAACAGCACTGCATCGTCATCATGTGG
GTAAGACGATGCGATCTTGCCAGCCCACTGCGGGTTCACTAAATCAGCCGGAGTGACAGGAGCAGCTTGGTCACCAAGTGCATTCATGTTGTAGATGAAG
CTGAACGAGTAGATCGAGTAAGCCAACCAAGTTCCGTCGTTATCCTTGAGAGAGTCGTGGATCTTGGAGAAGTTGGCAGGTTTGTAAGAGAGGAGGTCAG
CGTTCTTAGCCCAGCGAGGGAAGTCCTGAAGCGTCTGCAGAGCCACCACATCGGGTACCAACGTGTCGGTCTCCAGTTGGTTGTCGATGCGAACATCGTG
GTACTTGCTGTAGTCGACAATGACGGTGAAGTTGGTCCCAGGAAAGCGAGCCATGAAAGCATCGCGGAGCCGATCTTGCCGATTAGGAGTGTCTCCACCA
TGGTACAGGACGAGATTACCACCTTCAGCGAGAGCGTCGACGTAGAGGTCATCGATGGTTTTGAATTCCTCCCCAGATTTGGCTACTGCGCCAACAGAGA
AGAGAGACGAAGCCACAAGGAGCGGGGTCGCCAGGAACATGTTCTTTGCGTAGTGCAGACTAGTGTTGCTTGAGCCAGAGAAGGCAAATGTGAAAATGA