Description :
From Genome Similarity Track
Location :
Scaffold_65:289344- 291454
Sequence
2110 bases(100 bases per row)
TTTTCGTCACTGTTAACGAAAGGGCGGTTCCGCTGCTCAAAAGTGACGTCCATGGCGCAGATCGCGCACGGAAGTGCAAAAGTGCGCCCGAATGAAACCA
TAAAGCGCATGTTCTCTTCTTGTGCTCTCTTTTAGACTTGTTCGTCGTATAGTTTGGGGGTAGCGACGTGAAGAAACTTCATGATAATCTGGTATAACGT
AAGCGTGGCCACGTTATACATACGCGCTACTAAATTCCACATGCCGCCATTCTTGAAAACGAGGAGAACCATGAAAAAACACGTCCCTGGTGGCAAATGG
AGAGCGCTTGCATCGGACCACGTTCCAATGACGCGTCATGTTGTCGACTGGGAGCGGTAAACTCCCGCGGTGAGAATTTTGTCATGGTACGGACGGCGTC
GGCGCCGCCGTGATTGAAGAAGCGGTGGTACACTAGAGATCCAGAGCTGACCATGTCTTCTTCCATGGCGCAATCGATGTAGAACTGGCGCAGCTCTTCT
TGGCGATCGGCTGCTCGCTGGTCGATCATCTTGAGAGCTTAAAGAACTTGGTTGTGGTACGCGGCAGGAGTGTATGACCGATATATGACTGAAGTGACTT
GGATGGCTTGAAACCAATGACAAAATTTCCAGGTGGCATTGTACATTGCATTCAAGCTACAAGTATGGTTTTTACTGCTCAATTGTATAAAGATGAAGTA
AAATGGAGATGATAGCGAGAAATTGCTGAGATTTACGAAATAAGTTATTCATCTGTAAACTAGTTACAAAGTCTGTGACTGTTCCATATGGATGATTTGG
TTGGACACAGACCAACACATGTGGTGTTCAGATTCTTGACAAAAGTTCTAATGTTACATGAGCACAAACGGACCTATAATCAATGAACCCACCAACTTGG
CTTCGAATTTGCTACAAATCACGCACGTGCCACTGCATGTTGTGAAACCGGGACAAACGCTGCTACTCCTCTCGATAAACGGGTCATGTGCTGGCAAAAA
GCTACTGTATTGCGTAATTAGTACAGAGCGGAGTCACTTGTCACGGGAGAAATTTATGGCTACATATCCATTTCCTTCATATTTTAACCACATAACCATC
ATGGGTTTATGAGCCACGTAGCTAAGAGAGCAAACGAGGTAATAACAGTCAATGTTCAATCTAGAAAGCACGAACAACATACGCATACGTGAATTCAGCG
AAGATTGAATATTTGTATTGCACGGAACAGGTCCAGCTCGTAGAGGCGAACCGATCTGAGTTCAAGTGCACTGTAGATCGCTGCGATCGTGGCGTGACCC
GATTTTGCTAGACGCCACATTAGATTGGATTGTTACATAAGGACGTTCAAAGCTAAAATGAAGCCCATTTCCACTGTCTCACCTCAAATGTCGTCGATGA
TGGTTTCATCGTATCCAGAGTCGGCTAGTGTCGAAATAAACGATTTGACTCGTGTAAGCCTCCAATAGAACGCCTACCTGCACTACCAACTCCCTCCATG
TACACTATAGTTGATTAGTTTTCCAACACTATTAGCAAAAGCCTGGGTCACAACACGATCGCAGCAATCTACAGCGCGCTTGCACTCGGATCGGTTCGCC
TCTAATAATGTCGCTTATTTAAGTTGAAAAGGTTTTCAGCCGAGCGTATAATTATGCTTTATTGTCGTTTGACGACGTCGATCGCCGCATCATCATTTCT
AGGTTTTCTGACGTATCTTGATAAAAAATACGCACGATTCGCAATGACGTTCTGATGAAGAAATAAAAGTACAGTATGCAGACGTATACTCTACCCCTTC
CTGTACCCTTTCCAGCAACCGACGACTACATCTGTAACCTTTTTTTACAGCAGCGGTCACTAAATTTAACGAAGCGGTGGACGACAAACATTCTACACAC
GTAACCCAATAAGGCTTATGAACACGCCTTGACCGTTTAGTTTACAACCTCTCTGTTAATTGCGTAAAGATTTCTGCCGGTTAATATACCGTACGATGTC
ACCCTGTGATACCCGATTTTTCGACAAGAGTATTTTTCTGGCCGTCTTTTACTCAAGGATAATCAACAATTTCAGTGGTGAACCATTGAAGCATGCTGGA
AATTACGCAA