Description :
From Genome Similarity Track
Location :
Scaffold_131:28934- 34078
Sequence
5144 bases(100 bases per row)
CTTCCTCTGACTTAAGGAGCTGTGTAGCTCCGCTACACTTGGTAGCACTTGCAGTCAATCTACGCCTGAGTCTTTAATTATGGATCCTCTGTGAGGATGG
AAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAGTTCCTTGTATCGCAAGGCCC
GGAGGTGCTGACTGCACGTGTTGAGGTCCTCTTGCAGTATGAAGCGTCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTTGGCTATGCCTAAACGCTATG
TGTCTGTTCCAGACGAAGAGGCTAGGCCTCGCCCACTTAGAGTGGAAGTTAAAAACTACTTAGGAAAGGAGGGTGAAAACCTCATCCTCTAGATCCGTGA
GATTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGGGCCTTG
ACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGTGC
GTTCACGCTTTTTGTCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAGCTCTCATGGCTGCTATGCAGTCTGACCCTCTGCC
TGAAGCAGTCCATGCAACTATATTCATGGAGGGTCTCCGTACTGGCATTGCTAGAACCGAAGTCTTTTGGGTTCACCCCTCTACATTCGAAGAGGCTGGG
AGAATTGCTCTTGATACTGAGCATAACTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAATCCTAGCTCCGCGAGAGCACTCCACGAGTACTCCGGCC
GTAAATAGGCCGATACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAACTGCTGAGCAGCAACGTGTTGTACGACGGTGTTATA
CGTGCGGAAGCACTAAACACTTACGTCCTGGTTGCCCTTTGCGTAGACAGCTCTAGGCCACGAGTCAACACTCTACCCCGAGCCAGAAGTCTGGCATGGC
ACGGGGAAATGGCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAATAGGGCTTAGCCT
CAAAGGGTTCCATACCTACTGGTCCAGAGCGTGGATACAAGTCTGGCTTGTTGGTCGCTGAGGCAAAAGTTAAAGGCTTTGAAAAGCCTTGGTCGATTTT
AATCGATTCTGGGGCGTCTTGCAATTATTCTTGACGTCGTTCCCTTGAGGGAAGTCAGCGTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTCAATC
ACGGTTCGTTTTGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCGTTGAACTTAGATATAAAGTTTTTGGACCTTGATAGCATTGAACGCTGTCTTG
TCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTAAACGCCATGAGCCATGGATTAACTGGAGGTCTAAGACCTTAGGCACTAC
GCGCAATGTTCCTAGCGAAGCTTTGGAAGAGTCATGAGTCCACCTTTGCTAGGCAAAACAAAAGCACTATTGGCGCGAGCCTTCGACAGAAGATGTCAAT
GTGCTGGACACTGGAATGTCCGAGTTAACTAACTCCAATGTTGAAACATGAATTCCGAGCGTAGCTCGTTGAGAATTAGTGATACGGCACGTACTCCGTT
GAGTGTTACTCGTCGTGATAACGAGTCACTGCATGCTGCAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCTTTTGATGTTTGTGGGGTG
ACACGTAAGAATTCACTGAGTGCGGTCGGCCGTGAAGGCACCACACTTGATGTCGGTAATGACATCAGCTCTCGTATAGAGCGTACTACTACTAGTAGTA
ACCACGGGAAACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGAAGACCTGGACGTCGGTGGCAACTGTTAAGCGCCAGGAGTCCGTGC
AGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTGACTGGCCAGGTGGAGGGCAATGTTAGCCTGGAAACCCTTCCATCTTTGGA
TGCTTTTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGATAGCAGGAGATTTAGCCGAATAAGTGGTCATTAGACCCGATGTCGAG
TTGAACTCGTCCTCATTAATGCATGATTCGGTCCTAGGGGACACCAAGGCGGCACTCAGTGCCCGAAGTGGATCTTCGATCCTTAAAGATCCTTTGGATC
CATTCTATTCTTTGGTAAAGGAATTCTAAGATGTGGTGTGTCACAAATCCACCATCTGTCTTACCTCCCGATAGAGGTGTATGTCATGAAATTGACCTAG
TTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGAAAGAGAGTGACTTCATTGGCGATTTCTTTCGTGCTAAGCACGCGGCGGGAAT
GGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACCTTTTTTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCT
GCCACTATCTCGGCTCAGACACCAATCCTCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGCACAGTGCGCTCGACTTAGTCGATGGTT
ATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTC
AAATGCCCCGGCTACTTTTAATCGTCCGGTGACGCTACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGT
GCAACGAACGGTCGATCTAATGTGCATAATCACATTGATCATATACGAGCAGTGCTCGAGTGTATGCGCACGAACAAATTGTATGCATGCATCTAAGTGC
ATCTTTGGTGCAGAAGAGATTTTCTTCTGGGGTACTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCCGGT
TCCAAAGAACCAAAAGGATCTACTTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCGAATTACGCAGATATGGCTCGGCCATTATCCAAT
CTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTGACACCGAACATGATGCTTTCCAAGCAGTTAAGGAAAGTCTCTTTCATGCGCCAATACTGGTTTTGC
CTGATCCTGATCGGCCTTTTAATGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCAT
TGCATTCGAATCTCGACAGCTCAGAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATCAAGTACGCTCTAGTCAAATTCAGAGTA
CATCTACTTGGCTCAAAGCCATTTGTGATCTATACACTTCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGC
TTTCATTCTTTGCCAAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGTAAAATGCTTTGGCTGACGCGCTATCTCGCCGACCTGACTATGAGCTTTC
TCACGTCACTAAGCTGTCATCGTCAGTCGCTGACTTAATCCGTGTGGCTTATGTTAAGGGTGAACAATGTGTAGCTTTGCTACGTGCTCTTTGAAGCGAT
TAGTTTAAAGACTCGGACATAGAATTGTCGGCACTTTTACGTGCGAGGCTACATCGATGTTCTATTGATAATGGTCTGTTGTGCTATCGCACAGATATTG
AGGGTAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCCAATCCTCTATGAGGCACATGATACCGGTTCAAGTGGTCATCTCGGTCGCGA
GAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAAATATACAAGTGTGTGAGCACCTATGTGCGTACGGATGAAACGTGTCAACGGGTGAAA
CCCACACCACATGCGGCGGTGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTAGCGAAAGATT
CGGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGACGGATTGTATTGATGCCAAAGGTACATCGAA
GCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGACAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTC
AAGGTGCTCGGTACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCTATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGCCATTTGCGCAG
TGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTTTTCGCGCCTCTACAGGCTATACTCTGTTC
TACGTGAACGGTCTCACCCACCCTCACGTTCCTTTAACGCTACCACTATGTGGTTCAGGGCTTGTTGGGGGAGAGGTTACCGATCGGCTTGCTGATATCA
GCCCTGCTGCTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGTTTGAAAGTCTTAAGACATGTGCGTGACGCAATGGATGAAAGCCAAGACCAACA
AAAACAACAAGCAGATGCTAAAAACAGAGTTTGTATTGAGCGTTATAAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCCACAAATGTAGTG
TCCGCTGTCTTTAAGACAAAGTTGCGTCCACGCTTCATTGGACCATTTACGGTCACTGCCAAGAAGGGACGTGCGTATACGCTAAACCTTCCGCGCAAAT
TGTGCACACACCCGGTGTTCTACGTAGGCTTACTTAAGCCATAC