Description :
From Genome Similarity Track
Location :
Scaffold_712:2893- 7401
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_712-snap-gene-0.10Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
4508 bases(100 bases per row)
ATAGGGATATTCGGTGATAGCGGTTCTTATAAAGAGACATGTTGGTTGAAAAGGTATCCACTCATTTTCCACAATGTAGCCATCTCTTGTCAAAGACTTC
TCCCATTATTTATTTTATGCGTGTTGAACTTATGTTAATCTGGCACTACGTGCAACCTTCTCACTCTTCTGACACATGACAAAAAGGATTCTCGTGGCTT
ACTTGGCGTGCATCTTGACCTTGAAGAAGAAAGCCCAGATCGCGAGTCCAACGACAGCCGTGAGACCGCCGATGAAGATTGGGAGCTTGTACTCGAGAGA
CGACGAGTCGTAACCCACGCTTTTCTCCACGATGTAGTGGAGCAACGAGGCAAGAGAGTTTGCTGTGTACATCACACCAAGGTACACTCCAATATCCGGC
TTACTGCTCCCCATCAAGTGCACGATCAATGGCACCACGAGCACAAACACGAGTGTGCGCGAGAGAGTGATGAGCACGACCACGATCTGGGTCACAATCA
CGGGCTTCGTCACGAACGCCACGATCACCAGCAGCGCCTGTGGCACGATGGCAGCAGCCACGACCCCCTTGGCTCCAAAGCGCTCGACGGCGAATGGGAA
CGCCCATGTGAGCAAGTACGCTACGACTTGAAAGGCCCAGTGGCTACAGTCGTTTAGGGCATCAGAAGCCTTCATGAAGTTATCTTGGCTCAGGTCGCAG
TCAACACCGTTGCAGTCTCCCGCTCCGAACAGTTCCATTTGGAAGAACGGAAAGAGAGACCAATTGTAGACAAGATTGCCATAGTCAAACACGAATATCA
CGAGGCCGTACACGCACAACGGACTCGGGAACGTCACAATCCCTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCGATTTGAGCTTGGAAG
ACAGTGTGCGTACGTTCTCCAGACCCACCTTGGGCGACTCGTTTGCGGCAACACACGCGACTACAACCGCGATCAGCACTGCGATCGATGCCATTGCCAT
GTATCCGTGGGTCGAGCTTAGAGGATACCCGACAATCGAAATGTACCTGGACACATAGAGCGAGCCGAGGATACTCCATCCCTGGCTGATGGACGCGCCA
AGCACTTGGCGTTCTCCGGCAAAATCGGCGACCAGCAGCGACGTCGTGATCTGCATGATCGCGAGCGTAATTGCGAGCCAGATCCAGAAAAAGACGCAGA
AGAACTCCGTCCAGTTGTTGCGACCGCCGTTGAAAAAGCTGCTGTTGTTGGAGTTGCCTAGTGCTTCGCCGATATCCTTTGTGAACCCCATGAGCGTCAG
GCAGACGATGCAGAGGGTCGAGGCCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCGTCCCCACGTCGCTCGACTGGTGTCGCTGAACAC
CCCCGCCGTAAGCACAGTGAGAATCGTCGCGATAGGCATGAGTATCTGTACCAGGGCGTAATCCGGAAGTGTCACGGTTATGCTGGTGACCGTCTGAGTG
GACCAGGCAATGGGGATTGCCATGCTTGGTAACGAGAGGAGCATGAGCTTGGGGATCGACGCGTCTGGGCGCCGCGGGNNNNNNNNNNNNNNNNNNNNNG
TCGTCAAGCTGGCAGATAGCTTGTGTGGTGTAGCTCGTCTGGAGCTTTGGCGAAGCAACGGCGTCATATCCGCTCGTACCAACCTCAATGTCGGTTGGCG
CTATAGCCATTGCCAGTGGGAACTACAGTTGGTTTCTGGTGCTGGTTTTGTTGTTGTTGCTTTGTTGCTTTGTTGCTTTGAAGGCAAGTTGAAAAGTGAG
AGCGATAAGCGCTGTCGAAATGGTACTACGTTTATCTCGTGTATGGATGGACAGAGTAGGTCCCTCCATTGTGATGACCAAACCCATTCCATTGCTGCTA
TGATACAAGCAAACTAGGTTGAAGCCGTGTGCCCTAGTGTATCCGGATAATTACCACCCAGTGTATCAAATAATTGGAGAATGTGGATACATGTAGCACC
CTGAATGAATTGCACCCACAATATCCGATAATATGTGAACAGAGAGATGGGCTCCGTTTCTCCATCACAGAGGCGACAAACGAGTGGGCATAGCGTCTCT
CATACCGCAGCACCGCAGTGCTGTCCGGACATGCAACAAACTTCCTAGTCACTTTGCTGCAGATCGAATGATTCTAATTTATAGGATGAATGACCCAGTA
ATGTCTTTTCGAGGACTTCGAGTCCAACGGCCGAGCAGAGACAACGGCTTCCATGGACTTGAAGTACACCGCACGAGGGGGGAAAGCCAACAGAGAGCGA
CTTGCTTTTAGTACTTGTGAACGCAGTGCAATCCTCACTCCAGCTACGTACTTCTCCGCGGCATCACATCCGAGTTGCAGTAAGGTAGCGCATTGAGAAG
CTCAATGCGGTATTGAGTTCCTCCAATACGCTGTGTTAATTTTTTAAAACCGTACTTCCGGTAAAGTTGTTGCTTCCAGTGGCTACACTTCTTTATCCGC
TTCACCAGCTAAATCCGCATAGAGCGTATCCATTTTGATACTTGCAAATTTGGACGAGGCGGCGCTTCCCAGCGAGGCGTCTTATTGCGATCGTTCCTTC
GACCTCGCCCACTAGAAAATGCGGGCGCTATGCTTTTCCTCCCCTGTTTTGCGCAAGTACTACAGCGGCACGCTCTCCGTGGCGCACATCGTGTCTTGGC
TGCTGTTCCTGCTCGCGCTGCTCTTGCCGTTGCTGCTTGCGCATGGCTCCCATGGTCAGTGTAATCATATGCATGTTGGCCAGAATCTAGATGAGTACTC
ACTGGTTTTACTACGCTTGACGCTGTGTTGAATGCGAACAGAGTTTTGGATCCGCGTCAACATGTACCGCGAGCAGCCCCACGTCGCGTTGACGTATCAA
GTGATCAGTGTCCTCGAAGGCTTTTCTCAGGATCCCACCACACAAAGGAAGGAGTCTTTGACGATCGTGCAAACCACGCTCCCGTCACGGGTACAAAACT
TGCTACAGGAACATACGCGCGCATCCCAGTTTAAGGTGAGTGCATTATGCGAAAGCTCTCCATCGTTACTCAGCCCTCGAATCATGTTGTAACAAAGGAC
TTTGACGCCAATCTGGGAATAGTCCTTTGAAATTGATTCAGACCGAGATGGCCTTGCAGACTCGCTCCACGTGGAGATCGCCACGCCTCTAAATAAGTAC
GAGCAGATACACCAAGTGACCGTACTTGTTGTTCTCAACTATACGCTCCTGGTGCGTCACCATTACATTCGTACCATGGCTGAAGTGCTTAACCTTCATT
CTTTGTGTGTGTGTGTTGATAGAGTCACGCTAAGCTGAACATGGACGCCATTGCGATGCACACATCATCGTCAGCGCTCCCAGTTGAAGCGTTGCAGATC
GACGGGAATCTGGTTTTCGAGCAGCGAAAACCGCTTCACCTCACCCAAGGGTACGGCTTGTAGTATCGTAAAGTGATCTGAGTGCGACCGAGGACGCGCA
TAGTAATTTGTGGTATGCATGTGACCAGGATGCAATACCCGTACACGTTGACGCCAATCGTCAACGTCTCCAAGATTCAATCGGTCCAAGACCTCAACCT
GCTAGCCTTTGTCTCTCAGTACCGACAGCGTGATTGTACGTACAAGCGCAGATGATCACATGCTCTGTCCTACTATGGATCAACTTGAAATTCTGCAGGT
GCTGCGTACTTTCAGAGTCCGTATCCGATCTGGACTACAGATGTGAGTCGACCAGGTGTTGTCACGTCTCGTCCGCGACAGTTCCGCACCAAAATGGTGA
TTCGGATCCCCACGATCGACATACGGTACGTGCTTTATGTGGAGCTCTTGGAGTTGCTGGCTCTTTGCTTTCTTTCTTCAGTGGATCACTTGTTCAAAAT
GTTTGTCATGGCGCCATCGTAGGTACCATCCGTCGTGGTCCGAAGTCCTAAAGAAAGCGTGGATCCAGGTAAGGAATTGTATTACCTCATTGACTGCTAC
AATGTTCTCATGTACAGAGTCTGATAGTATATATTGTGCTGTTGAATGCTCTCGTCATTGCCGTGATGTGTTAGTACTACTGCATCCTCGTGCTTCTCGC
GAAAATCGTGTCGGTGTTGAGTGAGTTTCTATTCAAGAACAAGGTACGTGATGACAGACACCAAATGCAATTTCGCCGGCATAGTATGCGAGTCATTCAG
AGCACTAACGTGTGGGTCTCGCCATTCCTGGCTTTGGCATAATCGTCCGCAGGTTGTGGACACATTCTCTGTCGTTGACGATCCGACACTTGTGACCTCA
GCAAAGAAGCATCTCGCCTAAAAAAGTTGACCTCTATACAAGACACTGACAGTTCTCCTATAAAGAGGTCATCCTCCCAATTAGCATATTTCCTCTTGCA
ACTGAAGAACATGTATGACGTAAGCCAAAAGTACCGTCACAAAAAACCTCACACCCCGACTACTTCAACACTAAAAGCCAAATACCGGTAGCTATCGGTT
TGGCGTAC