Description :
From Genome Similarity Track
Location :
Scaffold_1410:2893- 4148
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1410-abinit-gene-0.2ATP-binding Cassette (ABC) Superfamily

Sequence
1255 bases(100 bases per row)
GATCGCTCTTGGTGATCGACGCGAGTGATTGCAGTTCGAGGCCAAGGAAGAGCAGAAGCACTGGGAGAAACATGCTGTAGATCATCATCTTTTTGTCGCG
CTTGGCAACGCGGAACCGCTTGAGCAACAGAGCCTTGAGATGCACCATGAACAGTCCCTGTGACTCACCGCCGCTGGCGACGGGAACGTCTTCNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCAGTCGGCGCATTTTCCTTTGGGCCAGGGTTCCGCGCTTGTTTGCCAAGTGTGTGCTGGTTGTCTTCGTCATCAGCCTC
AGCGACCTTGATGAACACTTCCTCCAATGTCGTCACCGACACACCATACGATAAGAGACCCAAAAGTGCTAATTGCTGATCCATTTCCGCGAACATCGAC
GCGAATTCTGATGAACTCGCGAGGGGAAGTTGGAACGCGATTTCGCTGCCGACATTACTTAGAACCTGCGCTGCTGGTACGTACGATTGGATGAATGCGA
TCAGTTGGTTGTCGTCACAGCCAGCATCGTCCTTGACCAGTGTCAAGTTGTACCCGGCGCCGAATCGATTTTTCAGAAACAGCGATGATCCGCAGCAGCG
CAACTGACCTTCAGCCATGATCGCGATGCGGTCTCCCAAGATGTCGGCCTCATCCATAAAATGGGTCGTCAACACCATCACACGACCATTGCGGTTGTTG
AGCAAGATCTCCCACGTACTGCGTCGACTATATGGGTCCATACCTGACGTTGGTTCGTCCAAAAACACAAGTGAACTGTCACCCAGCAGCGAGATCGCGA
CCGACAATTTCCGCTTCATACCACCAGAGAGCTCGCAGGATTTCACGTGACGCTTTTCCGTTAGTCCAACCTCCCGGATCTGGTTCTCGACGACGGCCAT
TAACTCTTCGTCCACGTATCCTTNNNNNNNNNNGATAAGCAAATGCTCTTGGACGGTCAACTCGCCGAAAAGCACATCGTGCTGGAAGCAAATCCCGAGC
GACTCGCGAATCGCATCCATGTCATCATTCAAGGATAAGCCTCGGAACGTGGCGTTACCGCTGCTTGCTGGTGTCATTCCCGTGAGCATCGAGATCAAGG
TTGTCTTGCCTGCGCCATTGTGCCCGAGCAAGCATGTGATCTGGTCTCTGTACATGACTAAGTCAACGCCTTTCACGGCGACTTTCTCACCACCTGGCAC
AGGAAACACTTTACGAAGTCGCTGGACAGAGAGCACATTCCCGTTGCGCTCTTGT