Description :
From Genome Similarity Track
Location :
Scaffold_37:28924- 30830
Sequence
1906 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGCTTTTTCATATT
AGCTCGGTTTCTCGCTATTTGTGCCACTGTCTAACCGTTCTAGCTTCCATACAACGCTTGACCGTCCCATCCAGGGCACTCGCGTCAGCACGATCATGCG
GAAATACTTCGTTTTAGAGAACCTTGTCTAGTGGGTATCCTGAGGACGTCCAAAACGCCTTATCATTGAGGAGCGATATGAAAATGAACGAGAAGTTTTA
TGGTGGGGCTTGGCCTAACACTGTTCGAAAAATACTCGACTGTGGCTTCGGGATAACATGATTGAAGTGGAGGCCTGCAAGTTGGTGTTTCTCGGCAATG
GTCGCAGGATAACGAATGAGGTTACAGCTTTGGGGATATGAATTTCTCAGCTACCAACACAGGTCCAACGCGAACACGTAAATCAATGCATCCCTAGCGG
CGAAACCTCTCGACCTCGATATCATTTCCTGCATTTCCTGCAAACTATCACTTTAGAGTCTAGGGTTTCGTGAAGGATTGACTACCGCTAGCTAACTTTC
ACCGCCATCGATTAACTCAAACATCCTAATTAAAACCGCCGCTCGAATCATTCGCACTATTTAGGGTCACTTATTCAGCTCAGGTTACTTCTACGTGAAC
GACATC