Description :
From Genome Similarity Track
Location :
Scaffold_158:28923- 31281
Transcript NameFunction/comments
Phymu_g5732conserved hypothetical protein
Phymu_g5733hypothetical protein PHYSODRAFT_480606

Sequence
2358 bases(100 bases per row)
CGTACACGGGTGTGAACGCCGGTGGCCCTGGCTCGTACGATCAGGTGACGGACATTGCGTCGTGCACCAAGACGTCGGTGACCACGTCGAGTCCCGTGTC
TCCTCTGGACACTGGTGTGACTTTGGCTCTCCGTGGCCCCATGACCGTCTACAACATCGCGGTGTTCGACGGTACCAACGGCACGTGGAGCAAGGTCTCG
TCCTACGAGAACGGCGGTGCTGCCACCAACATGGTGTTCCTCAACAACGAGAACATCGACTACACCGGCGCTGGGTCCCCCGAGGGATTCTGCGAGGCTG
ACGGCACGGGTGTCGCCCAGCAGTCGACCCCGTTCAGCGGTACGCTGGCATCGGCCTCGAACCCTGGCCAGGGGATCCTCGCTTCGGAGGCTACTGGTGC
TGAGGTGCACATCATGACCGAGAACAAGTGCGGTGTTGACGTCGAGTGCGAGGGCGCTTACGACACGGATGGCACGGCGTTCCAGGGCTGGACcggcggc
aagaagatcttcCTGACCAAGGTGTCGATGGAAGAGGGCGGCTCGCCCAACGTGCCTGCTATCTGGATGCTGCCGGACCAGGTGACTCACTCTGGCCAGT
ACGGGTGCAACTGCCGTGGCAAGGGCCCCGCTGGCGGCTGCGGTGAGGTTGACATTGCTGAGGTGCTTGAGAAGGACACGAGCTACGTGGCCACGCACTA
CTACTTCTACGACGGCACGTACAACCCGGGTAACGACCAGTTCGCCAAGCGCCCGACGTCTGGTCCGGCCACCTACGTCACCATCATTGACGAGGACTAT
GGTGTCAAGGTCATTGAGATTGGGGCGGACGATTTTGACTTCTCCTGCGGCACGATCACCGATGACGTCGTCTCGCAGTGGGAGGCCGCTGAGTAAGTTT
TTGCTCCACGTAGTTCCTTTTTGTTTCTATCTTCGATGGGCTTTTGTCATCAAGTTTCCCCGATTGCAGGCGGATGATAATAGAGCTTTTTGATCCATTT
TGATGTCATTCGTTTGAATTCTTTCGTCGCTTGATGGCGACTTGGGGCTCTACAGAAGTGGCTTCTCTACATGACCGAAGTGAAGTCGATCACGACCTTG
GAAgtttggagctggtgctgcatgTACTCGACACCGGCCATGTCCAAGAGCCGGCGTGATGCCACGAACTTCCAGCTGCAGAATGAGTCAACATGCTGAG
TTGGTTAGAGATCGGGTCATTTCGTTTCTTTGGTGTCTGAACGTACTCTTGATTGTACTTGTCGGAACAGTAGACGACTCGCGAGATGCCGCTCTGTGGG
AACACACCACCAGAATCAGTTACTTGACGTTCGTAGCAATGATACAAACACAGAGTAACAACCAGCACCTGAATAATAAGCTTGGCGCATTCATTGCAAG
GAAAAAGCGCCACGTAAATCTGCATGAAGGTGAATAAGTTAGACCAGTGAAGGGAGAATTCACACATGGCAGAAGCTTTAGTACCGTGCATCCTTTGACG
TCGGTCGAATTCTTGTTCAGTATGGCGTTCATCTCTGCGTGGCAAACATACTGAAGAGAAGTTAGCATCGACAAGTAGACGGTACCAAGATGAAGTATTT
TACCGGGTACTTGGTGTCGAGGGGTGAGTTGGTCTCACTCTCGCGTGCCCAAGGCAACTCATCATCTCCACAACCATTAGGGAATCCGTTGTATCCAATC
CCAACGATCTTCCGTTCTGGACTCACAATACTTCAAACAGCCATGTTAGCACTAAAATCACCAACACTCCCTCAATTCAACACACCGGCTTACCATGCCC
CAACTTGAGTTGACGGGTCTAGTATAGCCAAAACATTATCAGTAAACAATCCATATCCCAGGAGCTACCACACGCACACGAACCTTTCGAGCGCATAGCA
CTCAAGAAGGCGACGCTCATGAAATAGTCGTCCCACGACAAATAGTCGGAACGCTTTTGCACTGTCGAAGATGTGGTCGACTGCTGAGCATTCACTGCAT
TTCGCTCCTTGGAATCCGGAACAGGGTCGTTGCTGGCCATTTCCCCATTTCTTTCCTCTTTTTCGTTCGCTTCTGTCTCCGCCTTCGCCTTCCCGTTTTT
CTTCGGCGTTGGGGACTTGCTATTGGCCAATGCGGGAGTGGGGCTCGGATGAGCCTCGCGGGTAGCGGCCGCCACCCAATCTGGGTGCTTTACCAGAATA
TGCTGAACCAGGTTCGTGTATCCGTGCTTGAGTCGCTGGGCACGCGTCTTACCACACTTGCAGCGGAACATGGTGGGCGGATCTAAGTCCTCTTCGGCTC
CATCGACAGGCGTGGGCCGCTCTACCTCCGCATAGaacagctccatcatctGCCGCCC