Description :
From Genome Similarity Track
Location :
Scaffold_270:28923- 30625
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_270-fgenesh-gene-0.4Ubiquitin family protein

Sequence
1702 bases(100 bases per row)
AACGGCATGAACAACTCGATCCTAGCGGCCGACAACGAAGGCACTGGGACAGAGTTCTTGTGGGGGTTCCTGATGGGGTTGCTGCTCGGAGTATTTATGC
TGCTGATGGTGCGCCGCTCCTGCTTTGCAGCTGTAGTTGCGAGTGTTTGACTCACTGTGTCTGTTTTTGCGTGCTGTGGGCAACAGCTTCTGGATCGCTC
GGTCCCTCGAAAGCAAAAGGTGGGCTTGCTGCTCGGAGTCAGCATGAACTTCTTCCTGAGCGTCGTGCCTCGCGCCGTGTCGGACCAACAATAGAGTGGA
CATGGGAGTTTGTCGCTCCACCGATGTGTGCACTCGCACGCTCTACTTCTCCGGCTGCATCTGCGTTTGTACTGCACAGTCTCCGGTATCAGCCCGTCGG
CGTGGACGCCTCCGGTGTAGAGGTGTGTCCAGCCGACTCTCCACTGCTTGCCGTCCGCGTCGTGGCCGTCTCCAGGCCCTCCTGTAAAGTCATTTTGTGA
AGTACAAGTATTGGAAGCTTAGGAGCGCCTCGACTGCCAACGTCCGGCCTGTTCATCCTGGAGGCTGGGGCAAAAGCTGTTGCTGCGGTTGAACTGGCTG
CCTAGAACGGCTTGAACCTCGCGTCGATTATATCGATTAGACGCTGCATTAACATCCAATCGTACTCGCGCATTTGATGAATTGCAGAATGTATTGGTGT
AAAATACTGTTTTGGTGCGGTATTTGGCCAATCACAAGGGCGGCAACGGCGATCCGCGTTTGCCCTCACTGTCCCACCAACGAATTGGCCATTCAACACC
AGGCAGAGGAGGGACGTGACAGGGTTTCCGGTCGTCCTATATGCTGCAGCCGCTGGGGGACGAGGAAGAGAAGATCACCGTCGCTCTGGAGGAAGCCGAG
GCCGCTCCGATCGCGACCCAGGAAGCCGGCGCGACGAGCGACAGTGTCACACCGAAGAAGCGGAAGCGCAGCTCTGGTCCTGGAGCGTCGACGACGTCGG
GCAAGGAGCTCACAGCGGACCAGAAGGCCGTCACTCGCATCCACGTGACCCGCGAGAACACGGACGGCGTGGTCAAGTGCGTGTACTGCGACAAGGAGAT
CTCGTCCAAGAACGTTGACCGGTGGGCCTCGCACCTGCGCGGCTGCGTCAAGACACCCGAGGAAGTGAAGGCGCAGATCCAGCCGGCCCGCGCCACAGTG
ACCATGGCAGGCATCGTTGGCGCCACTGGCGCTCGCACTGGCAACCACGTTCCGATGTCGGCGATTCCCGGAGCGCCGGGGAGCTTGGCCGCCACGGCCA
GCGCTCACCTCGGCGCCATGCCAAGCGCTGTAACGGGCGGCGGCTACAATGAAGTGTTCAAGGTGCACGTGTCCAAGGACTACATGAAGTTCAACGCCGC
TCACTTTATTGCGTACAAGGTGCGAATGTTTGAGGTGGAGGGGGGATTCTTTGGTTGGTGGTTAGAGCTAACAGTGGACGATACAGGGCTTTCGGGAGAA
GCTGCACGGCCACAACTACCAGCTCGGCGTGACCATCACGGGCGTCGTTGGCCCCGACGGCTACGTGGTCGACTTTGGCGAGATCAAGAAGATTTCGCGC
GTCATCTGCAAGGACCTGAACGAGTCTTTCCTCGTGCCCATGAACAGCGACGCGCTCAAGGTGAAGGGCTCGATGGCAGTCGCGATGGTGTGTTGCGTGT
GT