Description :
From Genome Similarity Track
Location :
Scaffold_64:289219- 292866
Transcript NameFunction/comments
Phyin_T30-4PITG_17915Putative uncharacterized protein

Sequence
3647 bases(100 bases per row)
CGATACTCGTTCCTCGATAAATAAAGTGTTTGAGCATATTCATACGTAAGAAACCCGCTTGCACCCAACGAGAGATGGAATGCAGGATTGTAGATACTAT
TATTGAATACTGGATTCGGATATGAAAACCCAGAGCTGAGGCTATATAGTGGACGATAAAACACGATGAGCATCCCTGATTATGGGGTGGAAGTAAGGAG
GGACATTCCGCGGAGGGCCATGGGACAGACTGTGCGCAGAGACGACACAAAAAATTCTCACAGGCGTATTTTGCCCATTCCGATTAAGAAAACTCACTGA
ACGGCATATTCGCTGGTCGGACGAAGGTACTATTTCTCCGGGAAATGAGTGCACCTTATAAATTTCGGATTTACCCGTTAGTATATCGAGCTAAATCCGC
ATCGATCGAGCTGTACGATTATATATCAAAAACGACTTGAGTTTCTTGTTACCGATGCAGCGTAAAATGAAAAGTGAGAATCAAACTAAACTAGCTCTCT
ACATCCTTCCTGCACTGCCTACTGCAACACTCGAATTCTAGAAGATTGGAATGACTCCGAATGTTCGATGACACAGCAAGTTGCCTTTTATGTGCACCAC
ACAATCCTGTGACGTGGTGCAGACTTCAGCATATATCTATTTTTGAATATCATGATGGACAAAAAGAAATTACCTAAGTATCAAAACGACCAAGATGATG
ACAAGTCGTGAAGCTGCAATTCCTATCCTTGGATGAGTTGGATCGTTTTTCGGATGGATTGTCATCGTGATATCGTACTGGTACTGTCTGTATACAGGGA
ATAGCGGCAATAAGAAAAGGGACAAGAATTAAGTACTGAAGGCGTATACCTTACGTAAGTCAAAACAAATTGAGGAAGTCTCAAATGTACTGTATTAAAG
AATTAAAATCTTTCTAAAAACCATTTTAAAATGATAGATTTTAAAAAAAATCGCCCAACCAAACTTACCATATATGGTGGACCATGTGGTCAGACCCCAC
TTTCTGGGTTACCAGCAAGTACGAGCTCCACCACGTACTCTCGAGCCATTGCCTCGGTTTTCAGAGCTGTAAGAGTCTCGTCTGAAAGGCCCAGATAGAC
GAATATGTAGCCGCAAGCAGGAAGCGCAAGTTTGGGCTTGGGCGCCATCTTAAAAGTGAGACACAGACCAAATATCTCGCGTCTCTGGGACGGACACGCC
TCTGTGGGACGGACACGGCCAAATTAGTATTAGATTTTGTATACTGAAATATTGCAACGGACACGCCGCTTAAAGACGGACACGGCTTGTAATAACTCGA
TTTTATTAAATAAAAAACTGCTACAAAAGATTTTTTTGTGTCGTCTCTGCGCACAGTCTGTCCCATGGCCCTCCGCGGAATGGCCCTCCTTACTTTCACC
CCTGATTATGGAGGCTCGCTCCGTAAGAAATTCAAGTCAGCCTCGATGGGGGATATTCCAGCATTAGGTATCAAATTTTTGTTTAGGATGATCGTTTTGG
GCCCAACGTTTAGCGGAAAGAACAACCTTTGTTTATTCATTCTCAAGAAATCTCCTCATGCATTTGCTCATCTCACAATCATTTTTCGTAATCCATACCA
GGAACTCTATGACTACCTTAGGAATAAGCTGGGCGAATTCATAACGTTTGCTGATCCTGACTCACCACCGAGCGTCGATCAGGTGCGAAGGACTCCTCTG
AGCTCGAATAAACCGGAGCTAGTCATTATTGATGACTACAGCAACGATAAGCTGCTCCAGAAGAATCTATTCTCTCACTATATGACCCGAGGACAACATT
ACAAGTTGAGTACCCTTTTCCTTAGTCATAGCTACTTTGCTACCGATAAGATGATTCGATTGAATTCAGAGTACGTAGCGATTCTAGAAGCCAGCTCGAA
AAGAGATTTAGCAATGGTTGTCAACGATTTTAACATGCCCGGCGTTGATGAACGATCGATCGTCCATTACGAAAACCATGCTACTGAGAGAAAAGGGCAA
ATTCTACTTTGCGGTAGCGTAAAAAGCCAATTGCGGTATAATTTCGATCGACCTATCCGAACGAACGAGTAATTATTGATATCTGGATAAGATGTATCCA
TTAATATATCAACACTCTGGACGCCTTCCAAAAATGGAGAAATCACCCGACATAACTGCAGCAGGTATGTCAAGTGCATATCGTCGAATAAACCGGCGGA
GGCGTAAAAGTCGTCTCCATAACCTTCCCTACCCCTAGGTTTAATCTCTGTAGCCATCTTAAGGCTAGATCTTTGATTTTGTATTGAAAATGCTGACCAT
CGCTCTGACCCAATCCACAATCACTCCTACTGCATGTATCTGGCATATCTCATTTTTTGCGCCAAGTTGAAGAAGCATTCACTTTGGAAAATCGGCCGCT
GGGAGCAAAGCGCCTCTGCTGTTGAGAAGGTACGTTCACTAAGCCTTACATTGGGTCTTTGCTGACGATCTTTGTACTTTCAGAGCATGGTTCACTCGGC
TTCATACTGGAGCGAGCGGCGCATCGCTGACTCGTCGACCGAGGATGAAAACGCTCCTCCAAACCTGTCGCAATCGAGCACTATTAGCGAGCAGTATGGC
TACCGCTCTACAGGGACGCTATCACCGCCGCGAAAACCGAAGCCTGAAGTGACTCCACCGCGTGCGGATGAAGTGGTAGCCCTAGCGTCACCGCCATACT
CGCGGCCGCCGCACAGTCCGACGACGTCATCTCCAGTGCTACTGGAGACACCGCCAGCATCGCTTCCTCGCTCTCTGCCACGGATCCCCCTGCGTGATCG
TCGTAGTTCCCGGAGAGAGCGTCGAGAAGCTGCTCAACCCTATCACCGACGTCAGGATCACCGTCGTGAAGCTGCCTCTCCGTCGCTGAACCCTCGAGGG
CTGATGAGGACCAGTCCTAAGTCGTCACAACCACCACCATGTGCGCGTGAAAAGCGCTCTCGGGACCGCTTCGTACCAGCGGACTGGCCGGTACGTGTTG
TTCACCTCCGTACTCAGTACAACCCGACCGGGTTGGTATTCCCAAGAGTGCCCCATTACGGCTGGTGTGACTGTCCGGAGCCATGCCGTGTCGGGGCGTG
CAGGAACTCGCTGGTGCAGCTGTACTGTACCACAAGCCCAAGCTGCTGTCCATACGACGCTAAGTGCGGGAACAGTCTGGAGGAATCAACCAAGGTGTAC
TTGGCGAGAAACACGCGTACGCTCCAGTTATCTGTCGTCGCTGCTGAGGACATTGATGCAGGCGAGGTGTTGGGTCAGTACTTAGGCGAGTTCGAGCACG
TCAGCATGGATCCAGCACGTCGCCCACGGAACGAAGGATTCCGGTTGGTGATGACCCAACGACCGAAGAGGCCAAGCCACCCGATTCGTGTCGCCATCAA
CGCAGCTGAAATGGGTGGATTGATGCGTTTTGTGAACCACTCGTGTTCACCGGTCGCTCAGTTCGTCGAGGTCGCGAACGGACGCCGCGCCACGGTTATT
GTCGCCACTACAGAGATCGTACGTGAAGGAGAGGAGATCACCGTTGACTATGGCGGTGATCTTTAGTTCGTGTGCCGCTGTGGTCTCGCCTCCTGTCGTC
ATCGTGAGATCCAGGACCAGAGCGATCCGTAGCCGACGTGCAGTCAG