Description :
From Genome Similarity Track
Location :
Scaffold_168:28914- 33730
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_168-snap-gene-0.21FABB proteome
Pytir_DAOMBR486maker-pir_contig_168-fgenesh-gene-0.13Caltractin
Pytir_DAOMBR486maker-pir_contig_168-fgenesh-gene-0.63-beta hydroxysteroid dehydrogenase/isomerase family protein
Pytir_DAOMBR486maker-pir_contig_168-fgenesh-gene-0.14Conserved gene of unknown function

Sequence
4816 bases(100 bases per row)
AGCGCGCGTGGGTGCGTCATCACCGCGAGGAGTCCTTCCGGTGTATGCACATCGTCGCGTCTTTTGGGACTTCAGATTGCACAGAAGCCCTCGAGAAAGT
GCTCTGCTCCATTCGGTTCTACGCCGAGAGTGGCTTGCTGAGCGTCACGCCGGGCTTCTCCACTGTGCTGTTGGAGTCTGAGAAAGAGGACCCCGAGGCG
TTGATAAAGGGTCCAAAGCTTTCGACCTACCGCGTGAGCATCGGTGGCGCGCAGTACGAATACACGCTGGACAACGTGAACGATCTGCTGCCGCTCGTGT
CCACCATCGACCAGCAACTGCTGCGAGAGCTCCAGATCCAGGAGGAGAGGCAGGACGCCGCCTGCGTTGCTCAGTTGCTCTTTAGCGGCAGGGACGGTGG
GTCTTACAGTGAGCAGCAGCAGCTATACTACGACGCCATGAAGCTGAGTGGCGTGCTGAAGCGGAGACTGGTGCTCGTAGAGGTCGTGGAGGTTCGGGAT
CTTTGCTGTGGGGCGATTGGCAGCAGTGCACCAATGTTTGTAGAGCTAGGTTTCCATTTCCCACGTGGCAGCAAGCAGCAGCGCGAGCAGCAGCCTCACT
GGCGGCATAGAGCCACAGGAGCCAACAAGGTGAACAGTTTAAGTGGCACCGAGCTGGCAAACCGGACTTGCCTATCTCTTCCCAGGCGATCCAGGAACGG
TAGCACGCTCACAGTATTCAACTTCCACACAAAGTTTGACCTGGAGCTGTGCAAACGAACCAGCAAAGCCTTGGCTGGTGCGAAGGACGGAAGCGAGCAA
CTAGACCAGGAAGGCGATGATGGTGACGAAGGTTCCCAGATGACAGCGTCGCCCGTACTCTCGCTCGCCATCTTTTCGCGAGACTCCTGGGGCCGGAAGC
GCGCCGAGGGCTTCGGGGAGCTCACGATCCCACCTTTTCCTGGCCATTACGACCGCTTTGTGCCCGTCGCGAAGCTGATTTCGAGCGTACGAGAGCAGAT
GGAAGAGCTGTTTCTGGGTATCGGTGAGAGCGAAGATGCGGTCGCCAATGGCAGCCAGGTGAGTGTTGCAAGCACCACGCTTCGCAGTGTGAACAGCCGA
CTGGGGGTCCAGGTCCAGTCCACCGGCGCGTCGATCCGCGTGCGCTTCAACGTCGTAGATCAGTCGCCACCCCCACCACAGCCACATCTTCCACAAGTTT
CTTCTCATCCACTCAGTCAAAAGCGGTATGGAGCTGAAGCTGGGGCTGTGCTGTCCCACCCTCTGCCGGGACCACTGCGGGTCGTGAAGCGCAGCGTGAA
CGAGATCCTACAGGCCGTCAGGCTCGAGAAACGGCTTTCACAGGCAGGAACGGACCCAAGTTCTCAGTCATCATCTACGAGTTCCGCCACTTTCGGTGGG
GTTCCTTCGACCGTAAACGTGGTGCTCGCGCGGCTCAATGCAGCGAAAGCGTCATCTGATAATACCACCTCATAAACGAATACCACCTCCATAGTTTCAT
TCTTCATTGTCACTATGCAAATTTCGTACTGACTCACAAATCTCTTAGTCGTCATCACTGTCGAGATCGTCGAGCGGGTTCCCCGAGCGCTTCTTCATCA
CGCGGAAAAACTCGTCTTCATTGATGAAGCCGTCCCCGTCGCGGTCCGCCTCGTCTATCATCTCCTGCATCTCCTCGTCCGTGAGCGTCTCACCCAGTTC
GGCGCACACGCGTTTGAGGTTGCGGAACGAGATCTTGCCCGTGTTATCATCGTCGAAGAGCTTGAAGATCTTCTGGATCTCTTCGCGTGGGTCCCTCGAG
TTCTAAAGCAAATACGGGCATGCACTCAGCAAATTTCTCATAGTAGGCTGCATAGTGAGTGAGTGAGACGCAGGCAACGCACCATCTTGCCCGTCATCAT
CTCGATGAACTCGTCCAGGTTGATGGTCCCGGACTCGTCCTTGTCGATGTCGGCGATCATCTGACGGATCTCTGCTTTCTTCACTTGAAAGCCCAGCGCA
CGCATCACCGCCTTGAGCTCGCGTGTATCGATGGAGCCGCTACCGTCTGTGTCGAACAGCTGGAACGCCTCCTTGATCTCCTCCAAATCCTCGTCGTCTA
GCGTCTAGAGCAGTCACGCACACATTAACCATAGTCAAAACATAGGTTCAAATGCCCGCGATGTACTGCGCGCTGCGTACCTTCTTGATCTGTCGGGGTT
TGCGCCGTAGCGCAGCGCGTGATCGCGCAAATGCGGACGCTGACATGGTGGACTTAAAGCAGAGAGAGAGAGAGAGAAAGTCAGAGACCCACGTTAGACC
ATCGTATAGCAAGACGCCTGCCTGCATCCGTTGAGACATTACCATCTTGATTTCGTAGCGATGAAGGGCTCTTATCCGCACACCCAACGCTCTCTCAATG
TGCCCAAATGCCGCATTATGTTGGCTTTGTAGCTGCTCGAATGAATGAACGCGTTCGCGACCTTTCAAGATCCACCCCCTCTCAAAAGCGATCATACAAT
CATCAAGTTCAAGCTAATTTTAAAACATTTAACCGACATGATAGAAACCGCGAGCGTCATCAAAATCGAACTTTCCTGTCGGAGAAAAAGGGACACACAA
GTCTGAGCGAAACCGATCGAAGCTCTCCGATCAATTCAATTGCTCATCTCATTCACCAAGCAGCAGCAGAGCACACGAGAGCACCACCACCGCCGACGCA
CGAGAGCCAAAGCAGATTCCACATGGCGACAACGTTCGCGCAGCAGCTGCGCACGAGCGCCACCAAGTCGTACGACAAGAGCAAGCACCGCCTGCTGGTG
ATCGGTGGCAACGGCTTTGTGGGCAGCAACATCCTGCAGCGCGCCGTGCAGAAAGGCATCGAAGTGCGCAGCCTCAACAAGTCGGGCAAGCCGCAGTGGC
AGGACGTGCCCTGGATCGACCAGGTGGACTGGCACCAGGGCGACGTATTCAACGCAGACGACCTGGCGAAGGCCGCCGAGGGCGTCACGGGCGTGAGTAC
GTCACGTTGTTACGCTTTTTGTGTATAGACGGGTTATGTGGTGATAATGGACCTTGTTGAAGTGTGTGCTCACGTTGTCGTGTCTCTCGTGTTTCTCTGT
AGTCACGACCATCGGCGCGTTCGGAAGCAACGAGGTCATGGAAAAGATGTGTGGCGACGCGAACATCCTCGCTGCCCAAGCCGCACAGAAAGCAGGTATA
GTGTATTGACGCGTAGTAGTTGATGAGCAAATGTGGCGTGTTGGAGTGCTTGTTTGCTGATGATGAGAACCATTTTGGGTCGCAGGTGCTGAGCGGTTCG
TGTTCATTTCCAACTCGCGTGTGGGCTCGTACGTGCCGACATGGGCGCCGCTCTACGGCTATTACCACGGCAAGGAGCGTGCGGAAGCTGCGGTAGTCGC
ACGGTAAGTCATTGATCGTCATGCTCCCTCCTCAACCTGTTGACTCATGAAGTGCCAAATTATCGATTCGTACATCTGGTAGATTCCCAACGACGGGCGT
GTCGCTCCGTCCGGGATTCATCTACGGCTTGCGCCGTACGAACTCGTACAGCATCCCGCTGCAGCTCGCGGGCATTCCCATGACCGCGCTCTCGCGGAAT
CTCGGCGCCGTGTCGAGAGTGGTGTCGTACATCCCGTTCTTCGGTGAAGAGATGCGCGCGGCGATCCCCGTGGGCGCGGTCGCGAAAGCCGCCGTGCTGA
GCGCGATTGGGCCTGTGCACGGTCAGACGCTGGACACCACCAACATGCTCGAGCTGGCCGATTCCTTTCACAACACGCTCTGAGCTTCCTAGGTGCTCGG
ATCTTGTCTTAATCAGCAACACATTTGACAGCAACACAATGTCCACTATAAAACAAATCAACGCCAGAATTATAATAGCAAAAGTGGGGTTTGTTCTATT
GGAACTGAAATTATTTATCTCTTTGCCATCGCCTGTGCTGTGTACTTCATGCCGGAAAGTCCGATTTTCTTCTTGCGCTCTTCGGCGTCCAGTTTCCGTT
GCTCCAGCTCATTTGTCCGGTCTTTCCAGTATTTCTGCACAAGAGTGTACAGTAGTCGTTGTGTTAGCCACTTGGATGTCAATGACACAACAGTCCGTCG
ATGAATAGAGCATCACTGACCTCTTTCTGTTTCTCTTCCTGTTTGCTGAGCTCCTGCTGCAGCGCCTTCGAGTCTTCCTCTGTCGCCTTGATTTTGGTAC
TGAAGCAGATCTCGTCAAGCGTCTGGACCTGCTCGCATTGTTCACCGCAATAAATATGACGTTATATAGTGCAACATTGTATTGCGCACCAGGCTCACAA
TGTTGTAATATCTACCCAAAGATCTCGGATTGACGAGGATTCCGCAGTGAGCTCCAGCAGCTTTTGTCCATTGGAGCCGAAAATCACCAGTTCAAGCGAT
CCTACGTATCGTCGCAGTAACGCAACGTCAGATACAATCACAAATCATGTAACCAAGCAAAACAAATACAGAGCACCGTACCGTTCGGACACACTTTCCC
GACGCGATAGATCGGGATCTCCTCAGCTCTGCTGGAGCCCGTCGAGAGCTGCCAGAGCAGTCTTCCAACGAGATAAACGCGTTGTAAAAATCAATATCAC
GCCGGTTTGCATGTAAGCATGATAAGAGCCCACACAAACCTTGTCGCCGTCGGATTCAGCTGCAGATAGATGTGCTCGGTCTTGCTCAGCACACCCAGGT
ACGTGCTCTTCTTCTTGAACTCGCTGCCTTCCTTGAGCAGCTCCCGCCGCTGCAGCATCTCGTAGTTGCCGCCGCCGCAGCATACGTTCCCCATCTTTCG
CGCTCGCTTTCTCTCT