Description :
From Genome Similarity Track
Location :
contig_11:289139- 290416
Transcript NameFunction/comments
g2604.t1lectin, putative

Sequence
1277 bases(100 bases per row)
CTACAGCAAGTGCGACTTCATCAACGACTGGTACTTGCGGTACAGGTACACAGCACCTGCAGCCAGACCAATGAACAGCAGAGCGAAGGGCGTCTTCCAG
CCGCCGCTCGCGATGTCCGGATTCTCCTCCAGCTGCTTGGTGATCTTCTCGTTCACCTCGTCGCCCAGCACCTTCTTGGTGTTCTCCAGCGACGAGTCGA
TGCCCTTGCGTACCTTTGCCTCGATCTCGCGCACGCGGCGCTCGTTCTCGCCCTCTTGCTTCTTGAGTTTCGCCACGGTATTCTCTGTCTTCTCCTTCAG
ATCGGAGAAGCGGTGTTCAGCGTCGATACGGAAGTTCGACAGCTCCTTCTGCAGCACGGCGATCAGACAGTCCGTGCCGCAGTTCGGCGAGTCCATCCAC
TTCTTGTAGTCCTTGGACACCGAGTTCATCACCATCTCTGAGTCCACGGCGCCCGTCGTAGCGTCCGTGAAGTCTGTGTACGCGTCGAAGCGGATGATGT
CGTGGTTGTCGGCCAGCGCACCCGTGGACGCCGTGATGCCGATCGTAGACTCGCGTAGCCAGTCCTCGCTGAACGGCAGCGTCATCTCGTGGCAGGCCAC
CCACAGACCAGAGGCGTGTTCATCCACCTCCACCACGAGGCGCGTCTTATCGATCTTGACCTTGATGCGCGAGATGCTGTGCACGGGTCGAAGTTGGCGC
TCTGCTCATGGTAGCGCACGGCGGCGTTGCATCCCGCGCGCTTGTCGTGGTACATTTGGTCATACGTCTTGGTGCCGTCGTTCACGAACACGCTCACGTC
CTTGTGGCCACCCTTGTGCTCAGGGTTGTTGAATGTGTCGATAACTACGCCGATACCCTTGTACTTGTCCGTGAAACCGTGGTTCACGCCGGGCGTGAAC
ACCTTCTGGCCGGTGATCCAGAAACCGATGCCGTCGCCGAACCAGCGCTTGCCCTGGCCGACACGCGGAACGTCAGAATGGCCGACAGCTCGTCGCGTCC
CACAGGGCTCTTCTGCCACAGGTGGCCACGCTTGCTCTGGCGGTCGGTGGTGAGGCGGATGAAGTGCTTTTTCACGTCCGCGTTGCCGCCGTGTGACCAC
GTGGTGTTGACCATGCGACGGCCCTCGGCGTCCACGACCTCGAATGGCGGCTTGAACGACACGTCGTCCATCTTGGCGGCGGCAGCGGGGCAGGACAGCA
GCGCCATGCACGCGCATAGCAGCAGCAGCAGCAGGCCGCGGGTCTTCATGGCGTCGGGCTGACGATCAAAGCGAGGA