Description :
From Genome Similarity Track
Location :
Scaffold_3:289123- 291869
Transcript NameFunction/comments
g18770.t1RAW40653.1 hypothetical protein PC110_g3138 [Phytophthora cactorum
g18771.t1XP_009522810.1 hypothetical protein PHYSODRAFT_264516 [Phytophthora sojae

Sequence
2746 bases(100 bases per row)
GCTCCATGAACGTGTCTGCGGCGTCCGAGGCAAACGTGCGCCGCATGGACTGCACGACGTGGCAGCGGTACGAGTGCAAGGAGGACGGCGGGTTCATCGT
CACCTCGGGCGGCCAGCTATCGTACCCGTCGCGCGCGGACATCGACTTTATGGCGGTGGAGATCCTGTGTCTGCACTTGCGGTGGGAGAACCGCGTGGTG
GGGGCGCAGTTGACAATGTGAAGCGCCAGCGGCAGTCCACACCCTCGCCAAGGCGGCGAGGGACATGAGTGTGCAATGAGTGTGTGCGATGTGAAAAAGA
GGAGAACGGGAAACCGTTCGACGTGCAAGCCATAACAACAACACCCACCCCACCAACGCGTGCGGTGGGTACCCACGCTAATTTATTAACCGACAAACGA
ACATACACACTAGCAATTTGTCCAGCACTTCTCTTTGCATTCCTGTTATTATACCCATACAGGTGCGTCTCGCCACGCTACATCGTCTGCATAGGCTATG
GCGGCGCTCGTAGCGATGTACTGGAAGTGGGCGGACGCTGCGCGAGCTGGTACATATAGACTTCAAAGTTAGCGAGGGAACGCGTTAGAGTGGAGGACTG
TAAAGTGCTCGCTCGCTCGCGTGCCTGCTTGCTTGACCGGACTCGACACACGTTGGATGATCCAACCGGAGCGACTGAAAGCGCTTGGCAATCAGCGCTC
GCATGACCGTGTGTGCAATGCAAACAACTCGATGCAGAGGCTCATGCCTCTGTACGGGTGGCGTTCAAGCAACGTGGCATCCTGACCGCTCTCTATGGTG
CGCTTTGGTGGTCGAGAATCGAAATGCGCCAGCATTATCGTCAAATGCCGGCACTGGGTCCCCACTCGCGCTCCAGTGAATACCGTAGAGACGGTCTTAT
ACATGCATGCCGAAGGATCGTGCAATGCGGACTCGTCGACGACAACGCCAAGTCAAACTTGGTGTGTCGACTCGCTCGAATCCGAACAGCGCAGTGCGAC
AACACTCGTGCTGCTAAAACCTTGGCGTCCTGTGCACGGCATCCACGGGATCATGGTGCTACATGTAGATGGCACCGCAGGCGCGCCACCGCTCAACAAC
GCGGCAAGTGCAGCACCTTGTCCGACGCGAATGCACATGTGACAGTCGCATCCGAATGGTGCCGTCTTTTGGCGGCGCTCACTCTTGGTTTGATTATGCC
TTCGTTTTCTTTGGTGATCGTCATCTACAGAGAATAATACAGACAGAGAAGGAGGAAATTCAGCAGTCCGAGCACGGCGGAAATGGAGCTCCCAGACCTG
CCCAGCGACGTGAACGACGACCTGGAGGAGGTATTAGCGGCCACCGACCAGCGAACCAAGAGCCGCCTACGCGCCAAGCGCCTCTACTACAAGAAACGGG
TGCGCGGAGGCCCCGAACACGCTGCACGCGCGGCCGATTGCTCATCGCTTTGTGCTCTCGTTTGTGTCTAGAACCTGCTGGACGACCTCCAGCGCGAGGT
GGACGTTCTAGAGGCGCAGTACGAGCGCCTGATAGCCGCGCACCACCAGCGAGACGCCCAGCCCACACCTGACACCGCCACATCGAGCAGCAGCAGAAGC
AGCGCCGTCCACAGCGCGTACGTGCAGCTGGCGCAGATGAAGCGCGCGTTGTCCAAGGAGAACAAGGAGCTCAAGCGCCTCCACGCCAATTTCCTGGACA
TGGAGCGACAGATGAAGCAGCTGGCCGCGGCCCAAAAGAAGGCCCTCGTGCTGGCCGAGCAGGAACAGGAACACAAGCGGAGGAACCCCGTGCTCAAGGT
GAATCCGCTCACCCAGGACCAGTGCGCGGAGATCGCGCGCGCGTCGTACAGAGAGATCAAGGCCTTTCGAGAGAGCGAGACGTGCGTCTCGACAGGAACG
AGCGTCCTGGGCTGGCGAGATCGGCACGTGCTGCGCCACAACAAGCTCATGTTCTCGTTGGAGAAGACTTTCCACGGACGGGCGACCGACATGATGGCCA
GAAATATATGGGAGATACTCTCGCTGCCAGAACCGATTGTCATCATGCGTCCGCGCGACGCCAAAGTGCACTTCCACGTCGTGCAGCGACTGAACGAGGA
CGCGGTGGTGTACTACTACACACTGGAGCGCGAGGACACCGATGTGCGCATTCGAGCCTTCATCCTGGCAATGCACGTGGACCTCGGGCCCGCCGGATGC
ATGGTAGTTCTTCGCAATCTAGACCCCAAGACGTATCTCCAGCACGACGGAGACTGTACAGCACCCGTTCGCCGCGGTCGCCGGAAGGTTGAGCCGCACA
AGGAGAACGTCTGGCTGGATGTGTTTGTGTGGAGCTTCTACGAGTATGCAGGCGAGCAGCAAGACGACTGCAAGCAGACGTTCGGCGGAGAGATCGAAGG
CACAGCTCTCGCAAGCACGGGGTGGTGGTCTATTGAGATACTTGAGATGGCACTGCGCATGGAAAGCCGAGGGATTGGGTCTCGAGGGCTGCTGCGGTGG
TAGTGTGAGCGCGTTCGGACTCACTGTATTTGTTGTCAACAGCCGATGATAGTTGCTTGCTCAATGGAACACGATGCTATATTACCAGGATTCTCTACGC
GCAACCAGCCCAGCATTGCGTTCTTTGGACCTGCATCGAGCAAGCTCGCGTCTGCTGTCGGTCGGCTGTCGGTGGCAGTCGGCACTTGCGATCACATCTT
GGTGCGTGCCGCAGCCCTTCGAGGCATCCTCGGCCAGTTTCAAGCG