Description :
From Genome Similarity Track
Location :
Scaffold_19:289078- 295877
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007639Similar to Mosc2: MOSC domain-containing protein 2%2C mitochondrial (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G007638Similar to RNF123: E3 ubiquitin-protein ligase RNF123 (Homo sapiens)
Pytul_DAOMBR144PYU1_G007637Similar to Krtap16-1: Keratin associated protein 16-1 (Mus musculus)
Pytul_DAOMBR144PYU1_G007636Similar to Tub: Tubby protein (Mus musculus)

Sequence
6799 bases(100 bases per row)
GTGAGCAAAATGGACTGCAGTGCGCAATGGTAGCACATAACGAAAAGGTTTTTAGTGTACAAGGACAAATAGGTGGCTTGCATACAAACAACAAAATGTA
CCTTTGGACTCTCAAAGTTTGGAAGAAGCTTGGGGACAATCAGAGCCATCTTGTGGTAGCGTCTCTGAGTGATAAACTTCCCATTTTCATCGGCAAACAT
CCAATTTCGGTCATGCAGGACACCCTTAGCTGCAGACACCAACATTACAGGACTAAGCATGCTTCGTTACCACAGTTAGAGAATATTAGCCCCACTTACG
CGTGATCTCGGCTGAATCCAGGCGAATACCCGCGCACGACTTGATCGGGTACACGTAAACCCCCGCGACTTCCGCGACTTCGATATCCTTTTCTGGCAAC
TCCACAACATTTTTGTCACCATCACTTTCAACTTTGTACGTCTTCGTCGCAGCATTATACGTGAGCACGGTGGCGTTGCCGTGCGTCTTGGTCACGATCG
CGGCTCCCATTGGGTACACTTGCGAGCCGTTTTCCGCGAGCCGCTCCAGCTCGTCGTCCTTCTGCAGCACACAATACACGGGTGACGCTGCGGCAGTTGT
CGACTGTTTGCACGGTGTACGTCGAAAATATAGCATCGCTTGCGTCACCACGAGCGCAGCGAGCGTGAGTCCAACGACGACCATGGGTTGAACATTCAGC
TGCCAGCCCTACATCCAACGATATCGTCAGACCACATGCAAACGCCGCCAGAAAGACGACAATATGTGTGCAGAGAAAGCAGCATATTAGGACACACCTT
CTGATGGCCACCACCATTGTTGCCTACCGCAGCCACAGCAGCGATGCCCGCTACGAACGCCACCATCATCCGCAACACCCGCATTTTTGGCTTTTGCTGC
ATTGATCAGTGAAGCGCTGCGCCGTAGCCTTTTTCAATAGAAGATGGTATAGTAATTTACAGAATTACAAAAACCAGACAATTAATTTTCCATTGTTCAT
GTATCGTGCTAAAATAACATATAAATCTGCCAAGTAATCATTATGATCCAAAAACTACATGTTTAAGTCATATAGTTCTTACTAATAACAGAAGTAGCGT
CTTGGCATGTTCACCAAGCCATTATTTTACCAAAAACAAGTTGAGGGGAAAATGGCGGACGACGCGGAGTTTCTCGTGCAGTTCAACCGCACGCTGTGCA
TTTCGCTGCCGCGCGCTAACGCGACGGTCGCGAGCATCAAGAAGAAGATCCAGAGCCGCGAAGGCGTGCCCGCAGACCTCCTGGATTTGTACGCAAACGG
CAGGAAGCTCCTGGAAGATGCACTGGTGCCATGTCTCCCAGTCATGGTGCGCGCTCGCCTGAGCGGCGGCCTGCGTGGTGGCAAGGGCGGCTTTGGCGCC
ATGCTGCGTAGCAGTGGCAAAGGAGCAGGAGCCAAGGCGACGACAAGCTTCGGCGCGTGTCGGGACCTCAATGGACGACGCTTGCGCCATGTGAACCAGG
AGATCGCGGTCCAGAAATGGCGTGAGGACGGCGAAACGCGTGAGCAGCGCAAGAAGCTCGGCGTGACGGACCAGGAGATCATGGACGAAGAAACCCCAAG
CGGCATTCCTGGCTGGTACTTGGCTATGCCTTCGTGGGCCGAGGGTGTCAAGAAATCGTACATGAAACGCCGCCGCAACACGATCATGTGTAAAAGCTGG
CTCCAAGCGCGCGAAAACGGCCGCACCGCGCCGCCAAATGCGCCGAGATGGTGGGGGTGCCCTCGTGGACGGGATTGCGACTTTGCCCACGGCGAAGAGG
AGCTACGAGGTGCTGGGCTTACCGAATACAAAAAGTCCAAGAAAGAGGAAGTGTACCAGACAAAACAGCAGGAGCTACAGAAGTACGTCGACTATGAGCA
GGATATTCCGGACGACATCGGCGATGCGATTCGTCAGGGAATGCGCAAGCGCAATGCGAAGAGCAAGGTACAAGCGAAGCAAGCCATTTTGGAGGAAGCG
CGCGTGCTCCCACCTGACGCGACGTTTGTCGCTGTGCGATCGTCGGATGCTGCGTCGGAGTTCTGGCTTGTGCCGACTGGCGGAAATGTCGGCATAACTT
TCAAGAACGGGCTGTGTGAGCTTCGTGGACAGAGCAACTTTGGCACAGCGACGGTTTTTGGCAGCTGCATCACGAGTGGGAAATGGTACTACGAGGTGCG
ACTGATCACGGACGGGGTCGTCCAAATCGGCTGGGCTGACGGTACGTTTGGAGCGAATTCGGAGACTGGTGATGGTGTTGGAGACCACGTGCGGTCGTGG
GCGTACGATGGAAATCGTCAACTGAAATGGACGAATGGCCAAGAAAGCGAATATGGCACGCCATGGGAGAAACACGATGTGATTGGATGTTTGCTCGATC
TGGACGAAGGAACAATCTCGTTCTCGAAGAATGGTAAACCCATGGATGTCGCGTTTGATGGCATCAAGTGCCTAGATACAGACAATCTTAAGCAGAAAGG
CTTTTTTCCAGCGATCAGTGTTGAAGAAACCGAGATCTTACTCGTCAACATTGGTGCGCAGGCCTTTTTGTACCAGCAGGAAGGTTACCAGCCAGTACTG
GATGCGATCCGCGCTGACAGCAGTACTGAGATTCCTCGATCCGAAACACCCAAGGTAGTCGACGCCCCAACAGCACCAACTCTTGTGCCCGAGCCACAAG
AACCTGTGCAAGAGGAAGCTACCTACGAGCCACTCGACCTGGATCAGTTTGAATCCGCAGAGCAGCTCGAGAAGCTTGGTCTGGAAGCTCTGAAGCTTGA
ACTTCAACATCGCAAGCTCAAATGCGGGTATGTTTTTCTTTCGAAAATCGTTTATTTATCTGAAACGAGGTACTTACATACTCTTGTCTGTTCTTTTTTT
GCCATGTAGCGGATCTCTTGCGGAACGCGCAAAGCGGCTGCTAAGTGTGCGCGGGAAATCGTGGGAGGAAATTGACAGCAAGCTCAAGGATGTGAAAGCA
AAGTACAATTAACTTTGGGTAGGCTTCATCTGTTGCTTGTTACTAGTATGTCAAGAACGACAGTAGCGTGAACACATCTTAACAAAGTTTGCTTGCCTAG
ACATATCAGGATGGTCGTGTCTTTTGCTGATTTCTTATGTTTCTTTCGCTTTTACCGTCTAAAGGCAATCAGATAACGCGATGAGAAAAGTTTCCATCGG
AACAACGCCTATGCATACAGCAGAAATCCAACGCGTGAACAATCAGGTCAGCTCTTTGATATCATGCCAACAGGAACTGGAGAATATACACTCGCTCACC
TTTGCATTGCGTATCATACACTCCAAAGAGCGCTGTGACCTGGAATTTCAACAGTTAGCTCAGTCATTTTCTGTGGTCTTGCCGAAAGCCAGAATTCTGG
AGAACTGACCTGGTCGTCGGTGAACACACACGCCAAGCTCTGCAGCGCTTCTTTCAAGTGATCTTTTGTCATGTTCCCACCATCTACACCGTCCACAGAT
AGCAGACAACGTCATTAGAACAAGCGATGCCTGCTATATTCAAGTGCAGCTGGTCACTCACTCTCATGCTCCCGCTTCTCAAAACTGCGTTTGATGCGTT
GCAGCAAACTCGTTTGGTTACTGTGTCGACTTGTGATACTCGCAGCCGCGACACGCCACAACTGGAGTGCATTCTTTTTTCCGCCAACGCATTTCAGCGC
TTGCTGATACTTCTTGTCCAGCGAATCCGAGTACTTGAATGTCAAAATTGGATGAACTTTCGATGGAGTTACTTGGCTCGAAGGAGGATCGGGCGGTTGG
TTTGCTGTATTCAAAGATGGAGAAGGTGGCGCTGCTGCAAACTCACCATATCCGCTAGCATTGTCGAAAGCTCCGTATCCGGACCTCCCAGACATCTGAG
GTGGCTTCTGAAACTCACCATACCCGCTGGCGTTGTCAAAAGCTCCATACCCTGATCGAGGTGAAGTCGCAGGTCGCGCCTGGAATTCTCCATATCCACT
CGCGTTATCAAATGCGCCATACCCAGAGCGACAAGACATCTGTGGAGGCTTCTGGAACTCACCATACCCGCTAGCATTGTCGAAAGCTCCGTATCCGGAC
CTCCCAGACATCTGAGGTGGCTTCTGAAACTCACCATACCCGCTGGCGTTGTCAAAAGCTCCATACTCAGACCGAGAATTCGTCGCCTTAAGCTTGCCGT
GATTAGGTTGCGGTGGAAAGCGCACGCGGTGAGCACCGACATCTTTGTCGTGCATATCCTTGTAATGAGGCTTCTTCAATGCTTCCTTCTGGTTGTTACT
CAACACTGGCGCGCGGACTGAACCATGTCCACAAGTTGGGCTGACAGACTGAGCGCCACGAGACACTGCTAACCCTTTCGTAAACGTCGTTCCAATGTGG
TCCTGCTCATTGCGCAAGTGGCCCATGTAGCCCAAGATCGGCGGGTTCTTCTTCACAGGCTTCGCATCGTCCTCGGGCTCACTTCGCTGCGGAATGCACC
TACAAAGTAAAGCGAGAGCATTACAAAAATGGCTTTGGGGTGTGACGGAATCCCTAGGACGGTGGCTTTGTTACCCTGTGTATGCATGCTCTGGTTGCGC
GACGTTCTTCATCATGCGGCGCTCGTCGACTGTCGCAGCCAAAGACTCTTTCGTTGCGAGCGCTTTCGCTGACGACACATGATGAATTGGATTCCTTTTA
TACATTTTTCGCGTCAACGCTTGTAAGTGGTGAAGTCTTGCGCCGTGAAGCGCACTCGAATTTGAAATGCTTGGGGAGCAAAGCGTGTGGCTATTTATAT
TTGTGTTTTCCAGGTGCGAAACCACCTTAGGCACTTGCCATGGTTTCTCCACAATTAAATTGACTGAGTTTAAAATGATAAAAGTCAAGTGCATTATATT
TTATGCAGCAGCACTGAATGCAAAGTGTGTATACAAAGGCTTCTGAAACCATGCCTGACACCTGTCGCGATGGAAAGGACGGCAGTATGGCATGCTCTTC
ATGGTCTCTGTCTGCAGTCTCATTCGCATGCCAATTTCGAGTCGAAGCTGCTCAGCGTGATCGCAAATGCCTGCAGTGGACACAGCGGCCATCTGAAATC
CATCGTGAACAGATCTTTACCCACACGGCCGAACTGAAGTACGACCGTCTCTTGATCCTCTGGCGTCACCAGCTGGAAATTTTTGACGGATGCCATTGTG
ACGCGACCATTGAAGTTGAGCACATACGCACACACTTGATCGTTCCAGCGTGGAGGCTTGTTGATCAAGTACGTCAAATTGGTGTGGTCTTGCTCCTTGC
ATTTGTTGACCATTTCGTCTTCCTTTGTCAGTGGACGCCAAACCACCCGTGTGCCATCTTCCCGAACGCGAGGCACACACACTTTCATCTTTCTTGGCCC
ACGATGGCCCAACACATTAGCTGCGTACATTGAGATACCCAGCTCCTGGCGAATGCCCGCTGGATTCGACGTAATCGTCTGCGTATCAGCATCTTTTGGG
TTCACACCGTTATCATAGATCGCGAACTCCGTGCCAAGGAAGTTGGCACGCAACTTTCCGATGTAATTGTCACTGCCACGTCTTGAAAGGTCGCCTCGCT
GCATCGAGATGAGATAGTTGCTCGTACGGTTTTTTGGCCGTTTCTTGGCCGTGAGGAGAAAACGATCGCCTTCCTTCATGTACAAGCAGTACTCTGGGAA
CATCTTGTTGGCGCCAGACTTATTGCGCTCAATGTAGCATTCCAAGACGTCGTAAGCCTTCGGAATTGGACGAAGCAGGAAGGTCTTCATGTCTGCCATG
TCGAGTTTTGGCTTTTTCACAGAAACGCGAGGCTTTGATGACGTCGATGGATCATACGTAGTCGCGGCGTTATCATCATTACGTTCATCGTCAGACGACA
TATCTGGAGATGCAGATCTCGACCTCGACCTCGACCTTGAACAGGAACGAGAGCGTGATCGAGAACGGGATTGATCGCGAGCACCGCCCTGGTACGTACA
CAAATAGTAAGCAAATGTGGCACATTGAACGCGAATAATCTGAAAATGAGCAGGCATCGTACATTCTTCGAGCTGCCTCGACCTCTGCGATTCCCAACGT
CGTCGTCGTCATCATCGCGATCCCCACGACCGCTTTGTATCGATTGCAGTTGCACAAGCGTTAGCCTCAGTCATCACAAAGGCTCATAAAATAGATTGTA
CCTGCTTCGTTGCTTGACGAATTTGTCCGCTTTTGCTGGCGCCGCATCAAAATCTTTGCTTCCACGGCGCCGTTCAACATAATCATCCTTGTCTCGCGAC
GAGCTTCTTCCATGATCCGCCGCACTTGTTCGACTGCTGCCACTTTTGGGGGTAGACTCGCGATCACCACGGCTACGGTCACGGTCACGATCATAGTCGC
GCTCACGATCACGATCTCTTTCGCGTTCTCGGTCACGTCCACAGTCACGGTCTCGTTCGCGATCTCTGTCGCGGTCTCGTCCAGAATCACGATCCCAGTC
GTCACGCCCGCCACGATCGCGATCACGGTCCGACGCTTGCCCACGTCCTCCTCGATCTCTGTCGCGATCGTAATCGGCGTCGCGCGAGGAGCCTCGATCG
CGATCACGGTAGTCGGACCGCCGTGAACTGCGATCATCATTGTCGTCATCATCATCCATCCCTCGCCGAGAGTACGAGGATGAGCCTCCATAGCCTCGAC
CTCCACTACCACCACGTCCCGTGCCACTGTTGCCTCGACGCGTGGGGAGGACGTCGTCATCATCATCGTCTCGACCAAAGCGTCTAGTGCATAAGCATA