Description :
From Genome Similarity Track
Location :
contig_13:289039- 292004
Transcript NameFunction/comments
g3007.t1hypothetical protein

Sequence
2965 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTACACCCCAACATGACAGCACTTACTTTTCATAGTTGACGT
AGAGCTGAAGATCGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGGAGCCTGAGTAGCTGCAAAATTCGCTT
GGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAACAT
GAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACTCGCC
GCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTTGGAC
GACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTTCTTG
GACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAACTTGAAGAAAAACGAAGACGAAGGCAGCGATTCATCGC
TATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTCTTGAGAACCTGATACAGTTTCCGAGGC
TGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGCCCTTTGATGCACTTCGACGCTCTACACATCGAGAGCACGAGG
AGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCGAACGT
CAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCGGTTTC
GGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTCTACGGTTGGCTTGCAGGGTTTTGTCGCTTGATGGTTGAAGAATGCCTCCCTGTAGATCGTCTA
GAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACATTCCAGACTGGACGC
TGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCGCAGCA
CGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAATGAAAACCCAA
CACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAGCTTCT
GTCTTGCATGGCTGAATTGCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACATACTTC
CAGTTCTTCTTTGTGTCGCTACTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCCGATAAATCTTCTTCTTCGGAGTCACAA
ATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGATGTTGAGTGCGTACTGACCCGATCTCCTGGGTTGGCCACTGTCTT
CTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCCGCTTA
CGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGCGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGATGTCG
CCTCTGCATCAGCATCAGCAGTTTTCTCCGCAAGCAGTCGCTTGATGTTTGGATGATCCGCCATGAACTTACGAAACCCAGCGTGCACTGGGATTAACTT
CCTTGCGAGCTCTTCAACTTTGAACGCCTTGAATCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTCCACCT
GCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCTCGCGA
ACACTCGATCCTTTCGGAAATGCCTCGCATACATCACGTGGTTGATCGACACTTCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGTTGTCG
AAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCCACCACATCCAACCCCCTTCTCAACCAGACAGCACTCTACCTGCATATACGACA
GCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGCGGCTT
CTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCACTTCCCGATACCCG
AGGGTTAAAACGTTGGCGTCCTCCCAATTCTCCACCCGTTTCCGAGCCAGAAGCCGCTCGATGAC