Description :
From Genome Similarity Track
Location :
Scaffold_8:289023- 293473
Transcript NameFunction/comments
Sapdi_VS20SDRG_03346hypothetical protein
Sapdi_VS20SDRG_03347hypothetical protein
Sapdi_VS20SDRG_03348hypothetical protein

Sequence
4450 bases(100 bases per row)
ATCGATTCATGGTGTATTATATCAGAGGTGCTGCAAGAGATCCTTGCGCCGCGAAAGACTAATGGTAGGGGCCAGCGCTCATAGTTGCGCGGTCGAAGTG
ACGCTTGGTACAATGAGGTCTTTGCACCGCAGTCGTCGCTTGGCCACAACATAAGTTCCTATCCAGGCCACGACAGCAAGAAGGAGCCACGAGTAAGCAA
AGAGAAGCGTCTTGGTGAGTCCCGGTGTATCTAAAACGCAGGCGGGGTCCAAGGCCAACGCGCCATCGGGCAGAACGACGCTGCCACAGCGAGGCGCCCA
GCGGTCTTTGAGCGCACCCAGCACGATTGGCGACGGCACATCGCCGAGCACATGCAGCACCAACGTATTCAGTCCCATGGCGAACCCTCGGCGCGCGCGT
GACACGCTGAGGAGAATCACCAAGGTCGTTGCCGCCTGGGCCGCAAAGAGGGCAAAGAGTCCGAGGCCCTGGAGGAGAAAGAAAGCCCACGGCGTTGCGA
GGTACGCCATAGACAAGAAGAGGCATCCAGTACCGGCCACGAGGAAAACGAGCATCTGCATCGCGGCCATGAAGACGCGAAACGGCGCGTCGTCGGGGCG
GGCGACACAGCTGCGATCGAGGAGAACGCCGCCGACGGGCGACCCGAGGACTCCGGTCACGACCACAAGCGCACCAAAGACGGTGGGAGCTGTCGCGGCA
TCCAAGAGCCCATACCCGATGAGGATCGACGGTGCGAATGCGCCAAGGCCCGCAATCGTAAACGCAAAGGCGGCGAGACCGAGACTTGCGCTGACGAAGA
GCGGGTCGTGCACGATCGCAAGCACTTCTGCGCAGAGCGGCGTCGGAGCTGTGCTGTGCGTCTCTTGCAAGAGAAGCCCGTCATCCTCGTCGCCGTCGAC
TGTCATTGCTTCGTCACACGCAGCACCGGCGTCCGAGCGCCGCGGTGTCAGCTCAATGTCTGTGATGTCGGCGGTGACGCCCGAGACCATGAGGTCATCG
TCGTCGTGTTGGCACTTGGGAACGATGGCCCGGAGCGGGTGGTTGAACTCGGGCGGGATCCACGCCCAGCACATATAGGCGAGCGGCAACATGGCAACGC
CAAGTGCGTAGAATGCGACGTCCCACCCGAGCGTCTGCGCCATGATCGAGCCATACGAGTACCCAATCGCGGTGCCGGCCGGCATGCCAGCGTAGAAGCA
GCCGAGCCAGAGAGTCCGGCGGCTACGCGGCGCGAATTCATCAATAAACGCTGGCGTCGTAGCGTGGAACGAAGACTCGCCAATGCCCGAGAGGAGGCGG
CCGACGAGGAGAAGGAGGAAGCTGTCGCACGGCTTGGCCAGGCCACACAAGAAAAGCGCGCCCACCCAGACAAAGAGCCCAATGGCCGCGAGCACGAACG
GCCGGCGCGTCATGGAGAGGTACCCAAAGACGCAGATCGAGATCGAGTACGATGCGATAAAGGCCGACGCGAGCAGACCGACGTAGACGCTGACGTGGGA
CGGCGCGACGCCATACGACGCTTGGACGAACGCCTGAAACTCGATCGGCGCGCCGGGAATGACTCCCCGGTCGATAAAGTTGAGCAAGTTGATCGCGCAG
AGGAGGCCAAACACGTGCGCAGCGTGCATCGCACTGCGTGGTCGCGCTGGCTTGAGGAGTGGCTCGGCGAGGTCCAGTGCTGCTGCACTCGCTCACTGGC
GACAAGATCGCGGCAGAGTGATGGTCCTATCGATTTGATGACGCGATCAATTTTCAGATTTGTGCGAGGACGACTGGGCTTCTGACGCCGCCGCGCCGCA
CGACAACGCGGTAGCATCAGAGCACGTAATACTGCAGTCCAACTGGTTTCTTGTTAAAGTATACCAAAGTGGTTATCAAAGTCGCCCAGAAATCTGGCTT
GTTGAAGCTGCGGCGGTACCGTAGTATGCAGATCTGTCTGGTCTGGCACAGCCCACCAGCGCCGTCTCTGGGGCTCGGCAAGAAAGATTTGTCTCCACTA
TAGACATCGCATGTGTCTCCACTCTAGACATCGCATGCAATAGGCCGGGATTGAGTACTGGGATGCGCAACGACGACAGTACACACACAATTACACCATC
ACAGTTACCGACGAGATGCAACCTTCGCGACTAAAGCACCATGTCGAGCGCGGACGTGTGGTGCGCGACGACGCCGAGGAGGCCGCTGCCCATGAGCTGG
AGCTGGTGGCAAGCTTCGTCGACGGTCGGCGACGGTCGGGCACTGCACACGACCTTGTTGACGACGAGGTCGCGGTACGCCATGCGGAAGCACGTCTCGC
GCAGATGCGGGAGGCCGAGCACCGCCAGCGTGCTCTGGGGCGCAAACATGCTCGTCGAGATGCCGAGATGGTTGGCGCAGATGACGTCGAGGGGGTTGTG
GCCGTCGTTGCCAGCGACGACGCGGACGTCGGTCGAAAGAAAGAGGCTCATGCATTGCGGCAGGTACGTCTGGCACAGCGACTGCGTGTCGTTCGTCGAG
TCGCAGACGACGAAGACGGGGCCCATTGCGCGCGCCTGCGTGAGGAGCGCTACTATGTACGTGTCGAGGACCGCGAGCTGCTGGCGCAGCACCGGATGCT
GGAGCTGGTTCGGGTGGATCGCAAGCGTCTGGTGCAGCCACGTCGAGGGACACAGAAAGTTGTCCCAGCCAAAGACAAAGGCCGTGCGCGGAGGCGTGTT
AATCGGCGCCATCGCCGTCGGCAACGCCGCCATGTTGGACATCGATACTTGCATCGTAGTGGGTGGTATGGGAGGATCGGCAGTCGACTTTGGAAATGAC
GAAGAAGATCGCCAGTTCGATTGTTACCATCACTCTCGACGATTGGGCCAATGTTGGTGGCCGACCCACTGAAGGTCCAGATCCTGTGCCACCCTGGGCG
CGCGACCGTGTGCCTCATGATTGCACCTCGACTAGGTACAGGCTGGCGACGCTACGCTAATAGAGGTACTCCACAGCAGCGCGGATCGGCTTCAGTTGGC
TCCTTCCTCGCACGACGTCCGCCATAGCCACCACGATCCGTGTTCGACTGCATGCCATTGTTACGGGCGTTCATTTGAAGCATGGTACCACCCATCAAAG
CGATTCTGCTCAACCAACGACGCAGACAGTTGCTGCGCACCGCAGGTCTACGTCAACGAAAGGAATGCCAAGGCCAGTGTGCGACGCAAATCCAGGCGTG
TTGCTTGCAGCGTCGAGGCCGAGCGTTCCTACTCGAGCGAAGCCAATTTGCGGAAAAACGTGCGCCACGCCGGTGTCAAAGTCCCAAGCGCGGGGGCTGG
CGGCAGACCCACAGGAGGCAGTGCGCTTGGCGTCTTTCGCGCGCGCTTCTGGGGGGTTGCGGACGGGTCTTTGCGCGGGCGGCCTCGCTTGCGTTTGACG
TCGGCCGCTGGACGCTGCTATTGATTCCACACTCGTCATCAACTTGGCTTGTAGTTCATGAGGTGTACCTGTGCTTCTTGCGCTGCGACGGCCAAGGATC
GTTTACTTTGCTTCTTGGGCTTGGGTTGCGCAACGTTCAAGCGGGTGCTTGATCGGCGCGCGGTTATCGTTTCAGGCGGCGGGCTCGGTTTGGCAACGAC
AAGTGGTTGCATCGGCTTCTATGCGCTCACGTCAGTGCGTTGCGTGGCGGTATTGGTGCAACCTTGATCGGTGGCTCTGCGTGCCAGCCTTCAAGGTCCA
GAGTCGTCGTCGCCGTGGGCATCTTCTACGCCCAGCGCCTGTTCGTTGGCTGGGTGTCGCCAAAGACGTACCGCCGCTGTGGCCGGACTCGCTGTCGATC
GTGGCAGCGGAGAGAGAGGCGCCTAGGAGCATGTGGAAAGGACGTCTCTTCAACGCGAGCGTGCCCTACCTCGGGTGGCGCAATGACAACAACAAGGTGC
GCGCGGAACATGGAAGACAAATCTTCATACATCTAGCCAAAAGCTATGAGTCGGCGCACATGCTACGTAAATCCCTACCTCTGGATCGAGGATGTTGAGG
CCGTCCATCCCGTCGGCCAGGACCGTGTCCCAGTACGCTTGCTGAACAGTGTCTGGCCGACGCTGTCATCGCGCCAAATGATACGCAGCACGTGTAGGCA
ATCGTACCGTGTGCTGAGTAGGCGTGGCAGTCGTCGCTGGCGGCTCGGGCGGCGTGCACTACCATGGTGATCGAATCGGGTTCAAGCCGGCAGCACAGGC
ATACCGGCGGTGATGGCGTCGTCTGGCTCATGCCGCCGGATTCCTGGTTTGGCGGCTCCTCGATCTCGTCTTCGATGTCGCTCTCTTCGGCGCTGGAGCT
CGCTGGTGTCGGCGCATCGACCACCACGCAGCCGTCGACGCTCGGCGCTTCCGGCAGGCGATAATGCTGGTGCAAGGTGCTCAAGACGTCGCTCTTCGTG
CCCGAGCTGGGCAGCTGTAACGCCTTACAAAGCTTGCGCAGATCCGGCGT