Description :
From Genome Similarity Track
Location :
Scaffold_40:289011- 318762
Transcript NameFunction/comments
Phyca_LT1534571032pantothenate kinase, putative
Phyca_LT1534508957AlNc14C182G8248
Phyca_LT1534551068oxidoreductase
Phyca_LT1534551070protein pelota
Phyca_LT1534529216unknown
Phyca_LT1534551075dynein heavy chain, putative
Phyca_LT1534535685unnamed protein product
Phyca_LT1534551077Serine carboxypeptidase family protein
Phyca_LT1534508961mitochondrialprocessing peptidase subunit alpha puta
Phyca_LT1534571050Hypothetical protein

Sequence
29751 bases(100 bases per row)
ttggttccgtggtgacaggagtgagcaacacagaggacaatagttattttgaggggagtgcagctacatgtaaccccggtgaatacaattgcatttgtcg
tcatgctagaccaatccctcgtagtaatcataaatcacgtcatcgtgagtgatccaaactgtaacaacattgcccggccagccaaagtgacgtctttcat
tgcgtgacaaatacatatcgcgaccgcactgctccaccaaatgcctttacacgttttcgatgtgcttaaagcctgcggcgctgttttccagatcagcgtt
cagccctgctgcctccgccatgccagtggcggtgggtcccgatcgaaaccactctaacgcgtactctttgttcttctggaagcacaagaacgcttctacc
atagccgggtgctcagccagcgcagtctcgcgaccaatgccttcagtacgctgaagtacaccgaccacgttgtttcggacactttcaccacttgatgaag
ccgctgggatcgacagaatcatctcagcatacggtgcgatcaacgggaagcgaagctggtttgttttccaccaggtaagtgggtccacattacgttccga
aacaggaaggcttaaaaaggcactcagctccttctcccaggtggccaccatttcgttcgcaccctgaagagacgacttagacgattctgacggaaggtgc
gaaagcaaatcatcatcttcatcatcagcaagactgggcgacggactagtggactctttatccagctcagtatacgttgaaactgccaatctagcggcag
actccgcgccagactccgagagcgccgacgtattcgacgtttgcattgaatcgccatcagtgaacatccgacggagaaaatcttggccgacatcgcaatc
ggtcttgggggccaaataacagtattcacggttcttgtagcgagggtcgaacagcgttgcagcgtagcagacaggtggcaacgttgcgaactggccacgc
agtttgcgcgctagcacctcgaagaaacgcttccacgccgccggctccaaatgtcccggaatgctctcaactgctgattgcgcttgcttctccgcatacg
tgaccaaagccgcggcaatagtcgagacactcgaaatgccattcttgaatacttccttgtcgctgcctgtctttttgttcttttcaccctgaagcgcctc
ggaataccgggcaaatgcccgcaacttcttcactatcaggctaatgaactcaactgccgttgcaggcggataagctacgacatttgcagctgcgatctgg
ttcagtgtaggcaaatgattctgaaagtcacgaaggaattcgaagtatgacgcagtcccgcgtttttccggagaaagctcaacgtcgaagagcgggcact
tgcgtctaatagaaagcattgcatcgtcgttatttttcagtcgagccacaaagtcctcaatctgactgatcatttccggaaatgctttctcaaaaacatc
tcgagtcaagcagatacgcaggtgctgcacagctgatgtcaatagaaacgtactctgcgccgcgtcgggagacgcaatccgcccatcgaaattaacagga
acaaaaagtgacggaatatcggaagccgtcaaatcactcttcgcaggaagttcgtccttaatgcaagcaatcaccttgtccttgatccctagtcgctcca
ggtacgagtcaagaatagccttgaccgtctcgactccggcggattcctcaagtggagcagctcccactgcaatatcaaacagtctgaagtttacactaaa
gtgaatcttcacagcaaggtactgggtcggcttgagttctgtcgaactggggtgttgccacatctcaagcgacacagccacactcttggctctagctagg
accatcttcgtggtcaggaaaacactttcctgcagcaagaggatgcttttcccaatagtgtcttcactgggcagtagcaacttcttgtctccaatatctg
gttcatgacgtaatggatccctggcttggaagcaaagttcaacggcaaattgtccattagagccatcagagccaagtcttgagtgaattggtctgtattg
acctgcacaggctgtacgccgtaagcagacccgagagcttctttctgctccttggtaatggccagagccggagacgggaacgcgtaataagcagcagttg
ggtccctcttaagtgcagctgagaatactcctggagagcctccagcggcggccacagcagccgccagcgcttgagaagctccaggaggtgggtacatggc
tgcagccacgagttctccagcttgaccggccgcaacggcctgcaagccgagcttctgtcgcttcaaatggcgcttggtctctctgtgctcttcgcacaca
ttattggcctgctggtgcgtggcgtctgtgcgtccagccgtgcgtagatgcgatagcaggttggacgagtggtggcccttgatcacgcgctcgcagaatt
tacagacggagttgcccgcgttgtccttctcaaagtacgaccacacagccgagacactggcgggtccgtttgcgagcggcgccgcttgccctgcaggtgt
agaaggcgccgaagacgcagcggacgaagcaggcaggaattccgcactgcgcttcaccatagttattgacacagaaaaccggtatacgcggtactggtaa
tgggggagaatgggagtgtggcgcaaaggccgtttggatacaaaatcagatgtcgcctacaacacgtcatccgtcctaagtaaaaagttggaattacatt
ttaaccaatcggaggtttttagtctacttgaagtgaacgaaagggtatccgccgtattcttcgcggtatttggctagtacttgaccattgctgcgcttga
ggacagccaggcttgaccatgttgagccacattcgtctccgtgcactggtatcaatcggacgtcgaagcttctcgggttaggacttgatcttgagtctac
attttcgcttttgatgttcattcttatgtgcgcacgcagcaaccagtgacacgtccactgttggcttcatcggtctaggaaacatggggttccccatggc
gcacaatctactgaaggcgggtgtcgacgttctgtgcttcgacgccaaccgcgccaacgttgaccgcctcgtgctgcttggagcgaaacccgcgacttct
gtcgagcaggtcgctgctcagacaaacgcgatcttctccgtattgccgaaagatgaaattatcttggatgttgtgctaggagacaaagcgaagcctgggt
caggtttactggccaacatgcgtcccggagcgttgcacgttggctgctccaccattcacccgagcacgtcgcgttctcttgatgccaagcaccgcgaagc
aaaaaataaatacgttgccgcaccgatcttcgcgcgtcctgatggtatggaagctatgcaagcgaactttgtcgtgtccggatcagacacttttgcagtg
gagcaggcgtctcaatggctgcacaaatgcacaaacggccgcgtggctccattcagcacagaagacccaggcgcagcgaatgcggttaagctctgcggga
acttcctcattgcttcggctattgaatcaatggcggaggcgctgtcactgcttgaagccaacggtgttgaccgagtgcaggcgatgcagttctacagtag
cacgttcatgaactcggtgatccataaagggtatggacagcgcgtatctgagcgagatcatcgccctggaggcttcgcactggagctgggctacaaggac
cagcgtctggctcaccaattggccatggagtctcaagtaccgatgccgtttttgtcaacactgatcgaccgcttcctgagtgaacgtgctaagggccgca
gcgaccttgactggtctgctattggcctaggggtctgtgaatctcgcggtgccgatgttactgaagctatcgatcggtctcgtgcggggcaggcgccacc
tccacaccgaccgtgagcacatttttgatcaagttgaagctatttcgtcttattttgaaattgatgctttttagttgtagcaacattcattcaacatttt
cgttttgatcaaaaaacatttttttcatctcgcggtccatcatgaagctgctcaagaagcagatcagcgagaaggatggcgctggatcggtggttctgcg
tgcagaggagcctgaggacatgtggcacgtctacaaccttattcacgtgtcggactcggtcaagactacgacgatccgcaaggtgtgcagaacactaaag
tctgcacagttgataatgcatgaagtcgtacttaacgaattattgtcgtgttacggcgctttaggtggtgaaggagggtgtcacgggctcgaccagcagc
caacgtgttcgcatgacactgcagattgaggtaaattacgtttatgcagggaagtgttactttaaggtaacaaacgatgcttttaggttgagcaagtcaa
tttcgatccggcactgtgcgtgctgcgtatcaagggcaagaacgttatggagagtcaatacgttcgggtatgtcctagcggtgcactgccttattagtgg
aaggaaatgagatatctaatgttgcttgtccatgcagttgggagcttaccacacactggatctcgagatgaaccgcgacttcacattgacgaagaactgc
tgggacgtcatgtcgctggagcgtattgatatggcgtgtgatatcaccaagcaggcggagttggcagctgtggtcatgcaggtcggactggcgcacttgt
gtttgatcaagggcgacatgactgtcattcgagctaagatcgaaacgagtgtgcctaagaaacgtcctggtagctcggcccatgccaagggtacggaaaa
gttctacgagaacattgtacgctcgattcgccagcacattgatttcaagcttgtcaagtgcgtgttgcttgcaagtccgggttttgtcaaggacgatttt
ttcaagttcatgaccgagcaggctgtccgccaggacgacaagcttatcctcgagaacaggcccaaattcgtgttgtgccattcatcgtcgggccataagc
atgctctcgatgaagtgctcaacgatccggcaatccagtcacaggtggcggacacaaaggctgttgaagacgttaagtgtctggagcgcttctttaacat
gctgcatatcgaccaggaccgcgcgtactacggatacaaacacgttatgcgtgcaaacgcgaatatggcgattgagacgctcatgatcacggacgccctt
tttcggtcgcaggacattgccattcgccgcaagtatgtcgacctcgtcgaaagtgtccgggataatggtggcactgtgcggctgttcagtagtctgcacg
tgtcgggcgaaaagctggggcaagtaagtggcatcgctgccattctgcgcttccccatgcccgaaatcgacgaagaagaccaagacgaggagtctgattc
cgaggaagaagaagacaaggaagacgaaagcggggtcggggacctgtctgtcgaagctttgggtatgtagagagagtcattctgtcaggagataaatgct
tacaaatgcacgaagcaaagaggcaacactattcctccttagctgctagtgttgtgttgaacgacgaggttggacacacgcttatcgaacatctgcgacg
tgagacgctcgcctaacggcgcaaatgggttcgacatggcgttcacatacaggcgatgcacctcggagaagaactgcaatcaatagacacaacttacaag
ttaatacgcagtgtacaggttaaagctgaacagctcctaccggtctcagttcagattcacgcacaggagcgtcctgcagcaccacgacgaacttgacgga
cgtgttggtgacgtagccgtagactcggtagtcttcaatgggtcctagaaaccccagatacatgtcgtccttggacgtcgtgatgcctgcaccacgtagc
ttctcctctatcacgtccagagagacatgcgcaatgtaatggaaccctaaatcttctccttcctcgccgaacgtgcggatgtacagggggctattctgta
cagtattaacacagtattgattgtcaagtacataaaggtagggatggcgttgtcgtctagatagagagacgccagacatgcacttacagccgcgccgatg
acggcgacgcaggcgatcatgggcgaaaatgaagaaatgttgtgggaatgttgtttgaaagaatgatggtcattttgttgaagttacagtcagtcgtcgt
ccgagtcacgtgcagatgatggcggtgtgtactctggagtggcgtcgtcttcgtattcacttggagagttcgggttactcgtctcgctgggatacgcagc
aggagcttccgccccctcgtcgtaattactggaagacttagcaagtgtctccttcggatcttctgtaagagaatcttcgagctgtttgcctacggatcgc
ggagttgatgcgtcttcatcttcttgggctacttcagtctgaagttcagagactgcaatcacttctggtggttcgctagaatctccagtgtgagggtcca
gattccagacactgtttctgttgtcttcttcgttaccaccgtcgctgtcaagatttgactctggtacacttggagttagattccaaacagtatgtgtatc
cggatcactgacgatgtcagtatgaactgcctttagttggacattttcagttctatccggcagctcaccagcatcaggaatttgcccctcgtcagtgtta
ctgtctggggaggttgacacttgaggctccaaattccaggggttgtcagtattttctgtctttgggctcgggctgccagcaaccgcattgaggtcctccc
cactatttgagtctgcatggacgatttctttcgcagtacttccagcattttctggcgaagtctcgtcgttggtatcatcgtgggtgtgttgtatttcctc
ggaacttgagaccgcatcaagcacaggtgcaggctcaggatttagattccagactggttgattcacctcggttaaatgttctacatcggtgttttctgtc
atgtttgtagctgcgtggcgttcgtttggtgctggtgtcggatcagcattccaaatttctttccgatcattgccgtcatcgtcatttgagtcttctttca
ctgaatccgcttctacttcatgcgaaaccactgggtcttcaggcttttcttccgtaggaagggaaggacttatgggtaaattccacgcggtgctttcatt
gttgacatcgcttgatactgaattatcctgctcttcttcagcttcaacgtcatcatcatcgtcactatatacaactggtacatcatccggtggagaaatt
gggtcacctgggttgggatctgtattccaaatcgccctatctggatcctcttcacctgcctcaacgcttgacggttctgggtcgacattccaggctgcag
atttcacgttgatttcgtcattatcctcggcggaatccttaaaatcggcaattttgctctcattctggtgagaatcagacttgctttctggatttggatc
catattccaaacactaccaggatttgtgtccttagagttgtcatctctagcactgttgttttcatttcggtaaggatcaagcttgtttcctgaaactgga
tccatattccaaattgtaccaagacctgattccttacaattgctatcattctggtaaggttcaagctcgttgtgtggctttggatccacgttccaagcac
ccccatagtctgtttccttacagtgatcatccgtaacatcagggttttggtcatcttcgtacgtcttcttctccctttgaacctccattgcttcaccaca
ccttccgtcattttcgctttctttttcaagtgcatttgccgctggatcctctgacacggatttttcggggactttattggccttgtcaatgtccttgatc
tctttgttggttgtgtcagtactctgtacaacttcctcaccaggatcattgttccttggcgtgaatggctgagatcttgcactattgatgataaaatcag
tccgtctttcttgacgctcggtgtcttcgaggcgcttagcctctcgggcagctcgaatatgcaaattctcctccaattcacactcgacttctagctgagc
taaacgcacttgcttataatattcggcttccagtgctcttcgacgtgttttagatacaaaaccctctcgatggtcatatttcggtagcggtacgacacgg
acttggcccgtagcactctgagtggagctcattcttggaatactcatattctgcctgctgtctggactctcctgctcttgtagattcaatggttcgagct
tatttttcttcaccaaagtgctaccagaaacgtttgtgaccaaaggcacagctgaaattttgagcttgccagcaattgcagtgggtgaagacaccgctgt
ggtctctagcttcgctcgaaggcgatcgatctccgtatggcactcttcaatctcgacctcaagctcctgaaagcgaagaaatttgctacatactcgtgag
tgagcaaaacgcccagtgtaatattgggatatcgcgtcttacctgctgtactttaggcggtcaagttccttccttctctcttctgctagtgcttcagacg
tcgcagcctatctaaccaaagcgaaaaagtggatcactaccagcgtttacggatgatagtctatacattccgatgagtgttcgcattaccctttgcatac
actccgacacgagacggtcaataagttcctgtttgcgtgttttggtggtcttggcatcttgtggagatcgtaagatagcaaacgcagcttgtagctaaag
cacaataagtactgcgttagattccgtaccaactgacagaaggttaaccgcgtacatctttctctttctttcgcagtgtttcctgcaaccttcgagatgc
agttttcagctgtaaaatcaacgcatcctatacatgcacgttcatgttagttgtcttctgcatgtaaaattacctattcattgctcgattaccttctcgg
tgagttgtctttttaccaaaacaagctcctgcttggtgttttcccactccctccagccatcatccagctacagtaacataacaggtaagtcatatcattc
tccaaagcatatacaaacaccaatgacctaattcttcacctcaagctgctggtacggcgtcacctgcggttgactggcgctgttgccacgcctgctcatt
agccgcctcgccatcgtagagtgacgcacgatcaaaataatcgtcccaaaacgatagaagtaggacgggaaacgtcgcgatctcattgatacgagcggtc
agtaaccgaacaactatgggggaagcaccgagttggcagcacatgtggggcgccaaggtcaagatgccctgcgatatggaagacgacgtgctggaagacg
ccatcaagcatgtgacttcgagactggctaagtttgacactgaggaatgggagaaaaatggtctagcggtgagtggaccagtggtgtgtatcaacagtaa
gcgatggtagtttaaaatattgttttttgtaggtgtgtgaagagatcaaatctcatctggacgacgcgtgggatccgcattgggttgtgtgtatcggcag
gaacttcggctctttcgtgacgcatgtgacgagaaacttcgtcttcttctattacaacgagaaagcagtgatgatctacaaggcagggtgataagagaat
gctacagactttagttcatatctgacatcatcaaacgtattgcatttccacttcaactagtttatgattggtctaaattcgaattatcgtggtagccaac
agtttttgacattttcgcatcagaagccatggcacacgtcgcgaagaagatgaaggtggagcaccagcctctcagcttcagtgccactgacgccgacgcg
tccattaaaaggaaacaatgccagcgatgatgaagaagactccgaagatgagaccgggacgtctgctatcgcccagttccagagcgaggacgtgagtgca
ttgacacatttgttggcaatttggccctagagatgctaataccttcacttgctatgtgtatttcagggtaccagtgtaggtccccaactcgagatcccac
tgagctccaatgtccgccaaatggaggaattggtcaacgaactgctgcagaatggcaagaaccgcgtaccatactcgctgttcgttggagaaacggaggt
gacgacgtcactcaaggccacggtggaagaactggttcgtatctgcactattgacgaggtgatttttgttgagtagctgacgttgttgttgattttgatg
ttttgtgcagaaattgtcgacggaaacggcgttgaccatcacgttccagccactggcagctttccgtgtgcggccagtaactcgctgtagtgacaccttg
caagggcattcggaggctattttgcacgtgagctttagtccggacgggaagagactggcgagtggaggaggtgacgccacggtccgcttctgggacacca
acacatgcatgcccaagcacacaggtcgcggacacaagaaccacgtgctctgtactgcatggtcacccgatggtgcgcgctttgcgtcagcggaccgcaa
cggtgagattcgcctgtgggatccgctgacgggtaaacagatcggccagccgatgaaaggccacaagcaatgggtgaactctttgacctgggagcccatg
caccgaaacgctacttgcgagcgttttgcaagctcgtccaaggacggatcaatcaaggtgtggaatgctcgtacaggccgatctatcgcttcgttgtcgg
gccacacagactcagtagagtgcatcaagtgggaggtgaaggcttgctctacagtgcgtcccgtgaccgtacaattaaggtttgggcgatggagggtgaa
catgtgggcaagctcgtgcgcacgctgattggacacggtcaccgtatcaacaccttggcgttgaacgtggactacgtgtgccgttcgggcccattcagcc
acaacaccaagagcttcgcgtctcgggaggagatgcagcaggcggcgctgaagcggtaccaggaggtgcgtaagggccagccggagcgcttggtttctgg
ctcagatgacttcacgctgttcttttgggaaccttcggagagcaagaagcccctgtcgcgtctcacaggccaccaacagcctgtgaaccacttgagcttc
tcgcccgacggacgctacttcgctagcgccagctttgacaagaaggtcaagatctggaacggtcagaatggaaagttcattgccacactcacgggccacg
ttggcgctgtgtaccaggtttgctggtccagtgattctcgattgatcgtgacggccagcaaggactcgactgtgaaggtgtgggagctgagcgagcctaa
gaacgctaagacgacgctgtcaggccatgctgatgaagtatatgcgctggattggagcccgaacggcgacatggtggcctcaggcagcaaggaccgcacc
atcaagatgtacgtgacccttgttacagttgaagttgtcatgtcactaactttccctcatttctgtgtcttagttggaagcattaaaccaaaacgaatag
acctgatttttgtatgcaagttggtagagaagagatttcgtactttagggaataggcgccaaacccttcccgccaagcatcctcacttcggctttagcgc
gcggccagcagctcaaacgttcgttttgctgcttttactgctttaaccagtccccagcgaaaatgaagcgcacacgtgacgagagcaacatggaggacat
cgacatggacgccgttggtatgacgccgcctccttcgtctctttgggcctctatgtcgccctggaagccgccgcattcatccgtcaagcgctgcagagac
cgctctgtacctgttggtacgtgttttaacgtctcgttaaacttgtttcaactctgaaactaactgtcaaaatggtttttcttgacatgcagacgcgctg
agccgtatgatgtccgctgccgtcaccaacgcgcgcatcaagaagcacagtaccattggacggttgttcggggccaagagagagcctttaaacgcctgct
gcggcgtatgcgaggcccccaagcgccagtttgtggtcaatcagatgcagcgctgcagccactgcgagcgcgcgatgggcgactgctgccgtcgtgaatg
cgacgcgtgcagccacgtcttctgctcttcgtgctcgacgctaaactgtgacgaacagttcgaccgcgtcttctgtctgtcgtgcaacgaggaacagcaa
tgccggagctagaaactgagtcgggaagttttaattagtaattctaagtgtgtgttccaactgtactgcaggcctttgagtactaactgaacatgttcga
gcctggatcgtcgttcaggaaactgcggaccatctcgtacgcaatggcaggttgatcatgaggaaccatctagacaagagacagattagtgacaagagca
gaggtataaaggaactgggggacgtacgtggccagcattgaagactctcatgaagctcaggccgtgggaagtgcggacttggccgatactgcggccattg
aacatttgctcgttgaaggaggcagatctgaaggcttcctgatgcatccagtcgaggttacgcgtccaggaatcctgcgacatccagttgacgacggtgt
cggcgtcacctccgtagattaacacacgaacaccgtgctctaacgtttgaacgacgtttgactcgctctcttctagctggtccattgctgccagtcgctg
aagtgctccggatgagcacagcttccacttgtgaggtgcttcgtcgaagtatgctgttgctgctggggtattgacaaacgtctcgagacgggaaaatcgg
tagcacaactggatggcgtcgtcctggtgacattcacgacgtatgtcgtacacgtttcgaccaagattcaagacagcggtagcagtactcccttcaatat
tgttgagactttcgagagcagcatcgcaggcgggattgatactgtcagagtgacgcaaattaccgctcctcacacagtttgcgatcgtcgacttaaagcg
atcacttatttcgtgaaaatcctcttcatttgagccaagaaagtcgtattcatacggactggactggaagaatgggagtattgatgcagcccatgcagta
gtcgacactacgccattgccaatcgcgatccctttcagcgtcggaagtgagcgatcctggtcaagcattctcaccgccagatctggtacgtagtgacctg
cgtagctctcaccgaatatgtaaaagccgtttgctttgagctctggatgcaacagataaaactgctgtaggaactccttcatgtcgtctgctgcagtccc
gagtgaccaaggatgagtgattccattatctccgtcactgtatcccgtacctttgggctggtcaagataaataacgtgcgcgagtccagtccacgagtac
gggttgagcgagatggagtctgtttcatcatcaaacgaacaaggaccattctcgaacagcagcgcgaccaagccagagcacccaggaccacctgacaacc
acaaaatgactggaatgtcgactttcacagcggaggtttgataaaacacgtagtagagattgttgagcgtgccagtctccttggcaagattctctccaca
cagggacgttgttgtcggatattcttcgatgaggtcacttgcttgggcaaatagctgttcaccacctgacagcatgcaagtttgcgctactagcaacacc
aagagcaagcaccaagcgtaaaccttcattttcgatggcaagtggtaaacacaagatcgcggatgacgagtcactagtcgcaacatgcaatggttgcctc
ggaaacggttagtgaagacgttacgtaaaatctgcctactgattcaaaagaagatcgactccatgatgtggacaagatgctcgtaagcggcttgctgtgg
aatagcgcactgtggggcatctgacggtatttcctctggtacttgaaatctgggctggttcgagttgttccaccgatcgtgagcagcagcttgaggtgga
actctgaatgccatgaatggaagcgagttcgttgtctgctgctaccaaccatatcgacatgaagtcattgtgtgagccattgtcatgttatagcaacggt
ttgcccaaacctgaaccggcacccgtacaaactcggacttctgcaaagtgttacgggtttcacgcttcaaacttggaggttgagaagatttggtgacctt
gtttctgtccgacgcagcgaaatgctggggcgtcttgcttgaagagttggtcttgctgaatctgaatcgatcaaacgagtcaatagccgtgatcttcttc
tcgcgctttgccttcttccgctggccgtgactgaattgaatttcttcatacggacgcttcgactgcaggctcttccttgccccagtccctcctccctgca
ctttgattgcacttggtgctataaagttgctgtccaccttggcattctgttttggtaaatttctctttgaaaattgagcattatccttcaacgtggatga
cttgaacaccttctcgtgcttcaatcctgtcggcttcacgttctcgtctggccgcccgcgcttggctttttgcatgtaccggtccatccgctgttgttta
gctttcgtttggtgacttgtgagcgtcttgatgtagcggaggatgctgctgtcttcttccgttaggtctgcattgctcttcattgtcccgcgttccagag
tgatggtcttcaacttcaacacaatttgagtttattttgttgtttaaagaatcatttaaatctgaagatgtgacttcaactatctgttgaaccagcgctt
cttcttggacttgtgtcgactgtagactgcagcagcgcgtcggcctcgtcgggaaatagttagtgtagtcagtgacgagtttggtgctgctgatgacggg
gccttccacgagtccagcaacgaataccgtcgctccgaagtcataccgctcataccacttatggcgctcataccgctttggcggctcagatacgatgttg
tgtccgatgggatctcagccgctgcttgattccgacgacgtgtagttggtgcctgtgagatgaagttgctgacgttgatattgctcataggaatgtcacc
agctgcagttgacgttatcctgttgccgttgaccatcttaacatcaacgtcgtctggtttcagcggcaaactaccacgacgaggtcgcgtggcgaagata
tcttcgtcgtcttcgtgatcgtcatactcggctgccttcctggaatgatactgtgaatcgataggctcgtatcgagctcctaatgttgagtagcggaccg
atgtgggtgatggcaatggggaatttcgaacatcttctcccttgtaccgaaaactgcggggagcaatagcttctgtcaactcaacagttccaccagtaaa
gttgatgctctttggaggaagttggataaatgtgccatcgatatcaacttctcgatcaggaggaatactcttgacatcgactcgaatggaaggttctcgc
tctccatccacgtcaaagctctcaacacttgcagggatccctcttgctccgtccacatcgaaactctgagtgctcataatgttaggatctgctgattcga
ggtttgtagttccagcgcccacgggtggcttcgcttctgattgaccagtcttaattgagttacggagcattgaaggacggctttccagtgtaaagttgtg
ccagcgtcccatgaaacttcgcgatatttgcttcaaatgtgtttccttcggctcttcagcatgaatgatacgcaggacacgattcacattcgaaaggaga
ggggcctcgagctgctccttgttttctactaacccttccaggaaggccagcatctgagggtagtacttgagatctttcaaccagtactcgggatcatctt
tcgcctcattttctgtcagtgccgtactgcgagcctccaatacacgacgaagcaccttcagcaacgatgggatatcagggtgctgcatggtgattcgaca
aatcagcagctccacaaattctttcgaagtgatctctgggaactggaccaaacgccgagcgatacgcagaatacagcggtacgggaagcctgtgattaaa
tgatggttgcaattgcgtacaagctttacgatttgatcaggtatacgattgtcagcgatggtttcgtcgacatcaagcgacgctctcaaaatgtgcgtca
tagccatcgtatacttgtcaatttcatccgcaactgctttgagattgtctggaggattttgtagatcgaaactcatcagttggccaagttgggttctcca
tagctggaaaagcaaatccagattgtatgacgggtttgtcagcttttctggatctggtcgagacaagaaccgatcaatgtacaggcctgccacaaagttc
tcgggagccgggataaaatctgtcttatcatcgagcagaacagagtctcgtttgccaaccgatcgttctactcgatttcgacagataatttggtcgagca
ttttacgaacttccgttcgccggtgagaattccaaatcagatcacttttgtggtggttgtcatcgaagaatcgcgtagctttgttcggatccaggtgaat
ttggtacacgattgggtatgggagaaaccgacagagtccactgtacatcttttcacgcaattccatgtctttcatcagcaacgcgtacaaaacttcaaat
gcaggttctcgcagtgcttcagctcggaggaaatgctcgtgaaggacgtgctgtcttgattggagcgcgatacccagaatttcaacccatagaccacaat
cttgtacatactcggcaatgactaaacaagtatcgcacaactcggccaagcaagacagggcgtaatatgcttgctcgaaaccaaggtgatctgtgataac
ctgaagacaccacgtgaactggcaaaaaggttccagcatccgttccaagttacactcgaaaccacagattttgtttagaataagcagtgccatttcttgt
cgagccaagtaatccacattcccaaactcggtttccattgcggtagggacatcgtctgcttcggcctttgctttaaatccatacgtcgacagcgaccgac
gtgacgatatcgatacccccgccttagttttgtcatcaccgtcaaatggcagtagatatctgccaagtgtagcaaccgatattgacgcgttcaccgcatc
ttcatcatcaatgtgttgttccaagcactccacaatggcaggtcggaaggttggcaagtcacacagaagacttaaacagtccaacgctggcattgtatcc
gaataaattccaagctttgggtccctgttctcgttcaaaaagcaaaagagagattcaatgaaatccactgcagtagttgggaacagcgtatcctcggtaa
tcaaatggggtttttcctccgacttctcgagcaaaatcagcaagtaaatacctccaacatacggctccgagctgaggcaatcgtacatatagttggtagc
actttctaaaaacgatactccatcatcattagggtccgtgcaaaactcttccgtcagttgagatagttcgttgcgcgtgctttcgttccagatgcacgtc
ggttcccgaatatctgacaataaaattgtacagaagtcatgcccgtttggtttttccaggcgatctaaaaagtccatcggaagaagattagctagggcct
caagtccggcagatcggctgttgccatctggccccaaagctagcgatcgaagagctccaaaagcactttccaacatatcccgctcttgtttttctaacgc
agtggtactttcttgggtagtatcaactccagacgagctttcagcggaggccaaaatcaaatagagacccttccaaaacacccgtgtggaagtcatgatt
tgctgttgtagatcatgactacgacacagggaggatgctatctcaaacgacatcttctggatgtgccacggttggatattctcaaacgaaagaatcacat
catccagcaatgagtacacgcgctgcgcgtaccttgactttccagctccattttgtgacgtgtactccgtcgcagtaaagaacgacgtgttgtcatcatc
cccgaaggtgttaaaatcgaatgtcttcgacggcggtaccgagttcgagccattcttgtcgccctctacctgtagaagcgattgcaccccttcttcagat
gtaaggagcaactttaagatcgaaaacatggtctcctttgctgctacatcatggccgtacgcacaattttccaccagatcgagaacggcgtcccagctac
catcgattaaaaccaaaagtggaccattttggggtgcaacagataaaaggcgttctagaacctgcatggcttggaatcgaactttagcttccttagccgt
ccgagaagccaacacgcggacaagcaggtcaagtgtcgaagactcgtatgaaaaaaactgaaaaccatacttgtccaacaactgcatctgtgacttcaaa
atacgctcgataatatcatccgatgattttccgccaccagcctcattttttcgctcaagcgcactgcatagagaatcaaacgcttgacgaactgttgaca
attcaacttgttgccgacataactcccgatagcgtgagcgcaaatctgatgatgaaaacgtgatgtcttcgctccagccaaacagtttgtacgcatctga
atgatccatatcgtcatcgataccatccgctttacgacggaccaggtatctccacttctcctcgatacttttcatcatgaaaacgggatcttccacctcc
tcagcatccgaattagactggttaaacgtcgagaggtagaagccactacagtatacgtccccagacaactccaaataggaaattggagggatcggagtgt
agttgtacttcgctgtgacgctcgtaatcaagttttccttaaactctcgtagatgctcatccatcatctcttgcaagtgtaatctcatcgacgacgacca
caaaacacgcttgtcacgctttcgcccacaatacacgtcggagaatgcctcaggagtctctgagtccaaaaggccaatgagcgactcaggtagaatgtca
gttaggtaactctgacctacataccgctccaatggctgctgccttcgatgggttcttttcagtagtgttgcttctgggacaaaagcagacatcttgtcga
tcccttccggatttgcagccgtagccaaaatgaaatagaaggccccgtatttgtataactcatccagttcgtcgtcgtttaagtacaacagcatctcaca
gacgtatctccgcacgttcgcgttgtttacgagaagaagctggaccaacaaagctagggacgacgtattagccaccacaatattcaccagaggtggaggc
cacaaatttttgttcccaaccgttgctttccgttgatctttaatcataaagtttctcaacgacttcaaggcgaacgtggcacagtttgtgtcaattggtt
catctgtcaattccatccaacgcagctctgggtattcaaacatcgacttccatatgtgctcttcgccatcagaatgcgttgagcagcagcaaacatacag
agcatcaatctggcgatgccgaatgaaagggtcagcgtctaaatattccttcaggccatttgctgaaaaaggacctttgagcgttgtagtgtcatctgct
tctccgacagctttaagcttaatgctccatctgagtgaataccttgactcttcgtaaaaggaaagctctgcaatcggaacagatgaggtctcattcacgt
cggacacgaacgaatccatcattggtatatcaccgaggtcgttcgtcatgtcacttcttagcggggccacttggcatctgtgtgacagcaaggacatgta
caatagcactttaatgtgattcttcgtgcacaactcggaacaggcatctccagacagactcaatccagacagcaactccacaatatcttggatttcactt
gccagatacgaattccgcaataactctgtcagaaaacgagctcggtgcttggtaatcggtcgtgtttctggaaatacattggctagctcgatcaggatct
tcagcattgagtggccatgctgttcacttccagttgcgccagtaaattgagggaatccattgctcccacttgcagaccaatcacttgttcctgataatgg
aatattgttcaagtgaaggtgctccaaccaacactgatacacctcattgaaaaacttggctggatctttcgcaatatccatactagcgaaaaagaggctg
cttgaatttttcagctttccccgatgagttcctgcttccatcgatcgaacaaccttggcaacttctgccaactgcaacgatccgtcgcttattctttccg
taatcacgcgtaggtaaaaccggtcaacctgaagctcctgtacaatactttcgtatcttactgaaaactgggcgtgattccacttgggctcactgttccc
ttttcgagaagcaaccaacgatagcgcaactgcttgattagctttaaattgctcaaattcttcaatcgccgaagtgagtgcgatttgtagttcatctcgc
gtaacctcgttccaaatcaagtctggaagcataaaatctttgccaatcatactcgacagtaacgccatgtctgttgaagattcaccagggtaattcattc
gcgatgggtcttctttgactcgagcttctttcactgatccactagcaaaaagggttccaatctggagttgcatgcgccgaataaaccacgctgatccatc
aacttggctctgtaactggtgcttgcttttccgtcgggtagactcagtctgtcgagcacgctgttttttcaacagctttctaaccattgggctcgaaatc
attcgaataaatccatgtggaagaatcctcaccagcatttcatgagaagccttgtgatgagtcgcccaaatactggcaatgtactgatacgtctccttag
cattatccgaggggtggaaaaacgctttgtgcaggtgcttgagagttagactagagtctaaggcaaaatcgcaaattcgcctccgtactttatgatcacc
gtggtcaacaatcacttttaagacacagatgacagctgcagccaatcccgcattcacattttgtgatgctagctccagcagtagtgtgtacttgcctcca
agatctttcacgatggtatcaaaatggttgttatcggtactgtgacgagacaccaccagcacatccagtaccaactgcagcagtactaacgtggagcttg
gattgcgctgctccagaaggccggttagcagcgaaataagtttactatgctcaagcacttgaaagcgaatagccttctcagctgcccggtgagcatttga
ccgcgatttatcagcaatgagtgagtgaattgcattcaccgcccaaacagtagcaatcgaatccccagacaccaatatctgagcgagagtgggaacaagc
atcattgcaccaccatttgactgttccatcgcaagccgatagcaaccgtcattgatccggcaaaacgtttcgagaataacacaaatctcgttcgctcgaa
taggtggcttgcaggaatgctcgagctatcaagaaaaaaggtacgtcagtctcactataaaaatattatctatcatccatgaggcttaccatattgttga
ttccccgaagcaaagaactgaatgataacttttctaatcgcccacgcatcgccttccccgcaaaatcctcaatctcaacattcatattcaggctctccag
ggcaaaggtgactctgtttgttgccgatgtgaaactcacaccttcaccactcatcatttcaatctctttctctagaatagcatgtgctggaatgtagaaa
ccatcatgattgagatagagaaaccgttcgtgttcgtccttcagcagcgctcgaggcgacattctcgggttcaagtttgtaaactcacgacttagcgata
catcgtagttttcgacgtagcggtatccatcatacagtgctgcaagaaacttttcgatatcgtatggtacgtaaacaacacggctactatccgcaaactc
caaagccaccacagtttgactttcgtcactctccaatccaggaaccactacgcgtcgcaaattctttagatcgtaggtcttctttgaacagcttgaaaac
tcttcaatagtcccatcaacaaagcacagtttcttctttcgcaagtgtgtggatccatgtcttccagtccgtcgttgcacatcaaataagtcgtttgatt
gaaaagcggattggtcaagaggcctttccgcctgttgttttggaagcttgtcccgggtcttaaatcgaaggtggatcccaataacaccagccaaggcctt
catgttttcaacgatgtcattggtttggtcggagtaaatgaacttcagtttgttcttcacagtgaggatgaacgcgtctgggatcgtagtcgcttgagta
atctcttcaattgagcgaaactcaaattcatgagtatgttttgtcaagattctcacagcaatcagtgctctctgggtcagataaaacttggtcttttctc
gctgtccatccgctgttccgataaaaccactgaaatgaccgcaatcaacgctatatacgcgcttgaactcctcaaaattacccaccaaatgactcataag
ctcctgcaagaaaatattgcggcacctgtagcgaagacgcaagaagaccgagtcatcatactgatcaatccccatctttaacgagccacatgctgcctca
agaaattgccgatactgccttagaagaacttcgggattttgaacgaccaccacattaggaggaaggctggacccaccactcgaagatgaccctgatgacg
agaatgtgttgtttcgactaagtgcgtagttatttctcctagaagaatacaacgggggccgagagattggtgctccacgttgactacctggcccaaaatt
caacgtctctccaaagctgagtgattgccgaggtattttcccatcattagatcgtaacggagatcccatgttgccaaagtgcagaaatgctgggtttttc
gtcattctgctaagaattcccacgcacgcctccacggtacccaaagcaggaaaactaaataaaactcgcagcatcatgcggtatttcgtcgccaagtgtt
gatacagtgtttctgatagttgccgctgtttctcgacatttgctttcaccagtaacagaataaattgacacagtttcatcgttggcagatccgacaagaa
cgcgccagtctaaaatgtgcaaacagtcgtgtaagagagcaatcatgagcaacggaatcgcacccggcagacttacatgtgcatcttcgtctagcagtga
cagaagtgtcgtcatgaagagaccattcgacagcaacagttgtcggcattgaagcttatgtgctttcgactccatcaatcgactcaacagcatgaatatc
cagtagatagcaaccgagtttttgctcatcagaatcttggatattgtgcctatatattcttccccacgcttgaacacggcacaacccgaaattagttaac
ctcaagcccatggaacatgataaagtagtgcaatgtacctcagtcagaattttcataaattcgttgatagcagggggcgccagcgtcaagcgatagagtg
attgaagatacgtactcacaaaatcgtgcgttgcgccgtgacggcccactatgtcgtgcagctcgcgtgccaagacgtacaacaccttatcgaaaggctt
gtttggctgtgcaatcacaccggacgtaggcgtattgacatttagctctagcgatagagagtgcatctcttcgtcaaggccacgagggagttgccgttga
gtgcgtgctgtcttgcgatagccatgcactgcgagcaactgtaaaacaattgcttgcgcgacacggagctcacggtccatcacgttcacgttcggcaccg
tgtttgcaatcttgttgccttcttgcaaaatgactttccgcggtatcatacgaaccgagtccgcaacttcagtcatctccacaccgacctgatagttccc
cagtgcgtgacacgacgccagtagttcacacacgatcttttcacgctgtgctgaatagtatttccgcttgacaccgtccgcgtacacgacttcaaacgcc
tgtaacgtatcttgatacatgatcaaagtgtaaattctcgacaatggccgactggaaatgaccgtcttggcatctgcatactccgtaatatacttttccg
atacagaaagtgtgcgtggaacagcgctggactcatttgactgcgagaccttcaatacttgatattcaaacgacacactggtgcccaaagacgctttccc
atcatctttcaacgctgcttccatggttttctgcggtattcgttgatctgcatgccgtacgctttcataactctgctaatggcttgcgccagctctgtgc
gtcttggtacaatgaacagactggaattgtccgagtgatttaacgaaatagcttcgtggtcgtcgcagatgacgtcaatggagaccaaactcgtgtacgg
gatatgactcatgagatctccctcaatgtctcgttggtaaattccatcagggcggatctccacaacacaagtggattgcacgccgttcttgtggtacttg
agactttgaaacgcgtgcgtctgcagctcagcgggcgggggctgcggtgcatcaggcatcttggcgtagtgttggctgcgtagacgcatgagacagacta
gcacctccatacggaagtgacaacggtacacagtcttcttgatgcggtgacgtggtgtgtgaatgacgaaatccgtctcgccgtccagcacagtagcgct
atccacatcctcataaggccacgtgttagtgacctgttggttctctcggtccagtgtcgaaaacgagtattctccgaagcagagcacacgctccttaacc
acgaagctgcccaccttgtgcaccatgaagcgtgccaccacacgcttcatcgccatggtgtgggcaggtgcttggtcttcttggttgcttttttctttct
gttagttttctcctatgccttagagccttactggattctcttcttgcacttcaagtgaatcactacgcagcaagccttaacgatcttctgcttattcgcg
agtgggagagagcgcgaaaggtcgtgtgatacagcgagaggtcgactaagtacgagacattcactcttgggtcaacttcaactaaatggatcgtaattgt
gagttggccattgaccatgagcgtaggtatccttgtcgtgatgtggccattgatcatgagcgtgatatggctcagtttgtcgattaaatctgtgtacagt
atgaattggctacacggtagctgctatagcgatacgtcgcccggttcagaggaagtgttgggcaaagtcgaacttatgaatacacgacgaggtcggacag
gcagactcgaagaaattcggaggactgtagtgaaatggacgctagttgcaaggaatacagcatccacacttgcttatttcccaatctggatcaaagggtt
aattcatttgaagagttttgttattcgtcaaaatggtttattttccaccaatcacatacatccccatcgtgtgaggcccacacgcgccgcctcaccacca
gaagcacaaaaacgcacctgcacccccagcactccattgtccctctagatccctgtcgagatgcttgcgtcgtcgtcctccaagctcgcggcccgcgcct
cgcgctcgctgttcaccaaggccagtgccatgcccagcgtggctctgagtgaggagttcccctcggtccccaagacgcagccgcaggccgccgccgctgc
caagctcaccacgtctacgacctcgtcgggcttgaagctgagctcggacgaccgtgccgccactgtggccaccatcggtgtgcaactcgacaccggcgtg
cgtgacgagacggaggagaccgcaggtatctcgcagctgttcgctaagatggccttccgcgccactgcgaaccgctcggacctgcgtctgtaccgcgcta
ttgaggccattggcggtgtggtgaacgcccaggctggccgcgactttgtgcgttacagcgtcagcgtgctgcccgaccagctggatgctgctgctgaaat
cttggcggagaccacgctggcccccaagttcgccctctacgacgtggatgagcagaagaagattgtgcaggccgagctggagaagatcactggagacgct
actgcttcgttgattgagaacgtgcactctgctgccttttacgatgactcgacccttggccgctcgctggccactgctgagaacttgaagtccctcagcc
ccgaggctctgtgggcctactacgacaagtacgttaacacgtctaacgctgcgctggtcggtgccggtgtggctcacaacacgctgacggacctggctaa
cgagtacttcggttccctcgctaagggcatcaaggcttccagcaccacggctaagtacgtcggcggtgagacccgtgtcaagaaggccgccaagttcacg
cacgttgctgtggctctgcctacggtgggacgtgagtctgctgacttcggtgcttctcaggtcctccgtgctttgttgagcctgcgcctgaacaacaaga
aggcgtcggctttcctgtcgacctacagcgacgttggtctcttcggtctgtcgggctacgctgcttcctcggaggctgggcttctggtggactcgtttgc
tgctgagctgaagaaggccgcctcggcccctgcttccaaggaggagctggctgctgcgaagaacacggctgctttcgaggctctcgagcagtacagcacc
caggccggcgctttgggccgtctgggtctgattgccaccactggcgttgtgtccaagtcgccgtcggagctggttgagggtgtgaccgccgccaagctgc
aggagctggctcagaaggcactgaaggctaccccttcggtggctgccgttggcaagctatcggccgttcctcacgtggacgttgttgccagcaagctgca
gtaaacgactaaggcgtctgatcatgagtgaggtaaatacattaacagcccgagcttatggtgaagtatgttgaagtgaccttggaattgcgtgcggatg
aacaggaaagcgtcgagtgtggatgtagcgctgtgacgatcgggttagaacggaataacctcgctagtgaggtgacaaatggactgcagacacacccgca
gcttgcctctaagatcacgaggcgtgcgacggacgagcgcattaaatacaagaaaaagatacaactttttaacgacactgctaagaagccgctgttgtgc
cgcattctggcgctaatgttgtgagctcatcaggatggcttgtggctggatggccttcgttaggaacctcttagacaactctcaacatgtgactgtcggc
tcataatccatgataaacactcatgacttcggtgagttttgtaaaccgcaagctgcctaaaatctgtcaaattttacatgtaagagcctttgatgcctaa
tgacttctcgagccgacgaagtccaggaagcgctaaaaatccttgcatagatataggcttgataacaccagcaacatgcggtggcagctggctgttctta
ggctttattcgttagtgttttgccctgtacagtccgttgtctccttctccacattcgacctcttttccccgcgttcctggccacctgtagcgggtgcttt
gctggcgactgtcgccacctctgcatcgaacagctcgtcgctgctgctgctaatgaggtctccttggcccccattctgcaaatgaccacacaaaggttgc
ctcgatccagtccaccaacggcaaatcgatagttgactgatcttctattgtgctagctgcatctattagcctccagtggccgctaatagaggccctccaa
ctacctacttgtccttctggtaactggtctcgtcagctggccacagcgccccccaatgtgctttacgcgatgcacgatacacgtcacgaaccgactttcc
cttcgtaacactgcgacgttccagcttcccctacaaatggcaaaacaccgagtccgagtccgtcagaaattgcgccgaagtacatggcattcaaccaaac
aatcttacatcaggagtacacaggtcaagatacacgtgacgggtagcaagcaatggagctctaagcatgcgtgcaactggtttcttcaacttcgccgccg
catcctcctcacttcccttgcgagtcttctgcataatcatataagaaaacttggatcccttctgcccattccagcgcttggtggttgcctcacggggacg
gtttactgtgggcgagcgctgcacaaagtggcaccaagtacttcctgctgcaggacactgttcagcatcgcaaaatcgcgttagttcgttggtcacaaca
acttttcgttgagcaacttacctcaaagtgatgcggacatggggccacaatatggacaccatccttgctctcctcatcttcagcaacggaatccatcaca
aattgtcgggccgaccgcacatggtgtgatccccacgggcttccacgatccacaactaccagacatccgttctcgctcagcaactcccacagagctgaag
tcgtggccacccgctcgaaatcgttggtgatgtctgataatacatagctcaccacaatgaggtcgtacttgttcccagcgttaatatccctagacatgtc
ggcgatgctgcgacgcacactgaggcccggaaagtcctcaagcagcacctcagccgcgtccaccatggactgactgggttccacgacgcgaaacttgtcg
attgagtcattgtaaaagtctttggcaacccaacttgccgtaccaggtcctgcaccaaagtccagtacagatttgggcttgaagtccggcagtcgtttct
gcagttcggtgaacacagcatgcgtgcaggcgtaggtggcctccatctcgaaggctaagtaggcccatgtctcgcccggtccataggcgaagggtggaat
ctgctggctgcggtccatagtccagcccagcggcgtcttgctcatatccagcggcagttgacgcgtattccggcggtctcccacatgcttctgacgtagc
gtcgcgaactgcgagtgtgtgcggctgcgaatgacagaggtcaaacgttttagcatctccgtcggcatttccacgcgctgcaccaggccattgcgcgaga
gttgctcaatgtctgcaagaatggacggtgtacgcgggtcggccgtgtcagctgccttagctttggctctgcgaagacgtcgagcacggcggttggcagc
aggtgaagagaaagaggcgcacagcactggagcactcctggacggcgtcaggaggcctgtacacgcgccgtttactgctcttagcgtccgcagcatcatc
aggactggtggtgaccagggattggtagtagaaccaaaaatatgattctgg