Description :
From Genome Similarity Track
Location :
Scaffold_1058:289- 6135
Transcript NameFunction/comments
Phypl_g12208hypothetical protein
Phypl_g12209hypothetical protein PHYSODRAFT_480856
Phypl_g12210reverse transcriptase

Sequence
5846 bases(100 bases per row)
ACAACTGGACCGATGGTCAGCTTGAAGCAATCTTCTACCAAAAGGGactgaacgcgctgctggtcgagggTCCAGTTCTGGGCTGAAGCTGATCAGTGAT
CTTCGAGGACCCGTAACCGCGCTCAGGGAAGTGCTCAACAAGCTAGACGCGTTGAAGCTTCTGATGCGcatgctgaaggaggcgaagGTTGTGCCAGGAG
CGTTCGACGTGAACAACCCGTTCAACCTGGAACTGACCGCGATCACAAAGGCGACGCTCGCTCTCTTCGAAAGGCTGGCTACTCTGATCGGAGTGTCCAC
GCCGGCTGCAACGATGCTAGCACCGCGCAATGGTTCATCGCAGTACGCGTCGGCTACGTTGGATGCTGGATCATACAATTCGATCGAGGTGAAGAGAATG
ACCCTGGGACCAGTCGGCGTCACCATGCTGGAAGCTCGGAAGAAGGAAGCGAAGCTGTCCTCGCCACCGGCCGCGCCATTAACCTCCGCGACGTTAGCAA
CGGACCAGGACTCGCCAGATCGCATGCAGACGTTCTTCAACGCTGCGATGTCTCGATTCTTGAAGGACTACCACGTGAGCAGCCACATATGACACCACCG
CGGGAGCAGCCAAAGTCGCTTGGGAAGCCGAGGCAGATCGATGCGCCAGACGTTAAGATGGTGTCGGTCGGATCAGATCATGATCCACCTCCGGCGGATG
AATGCGGTCTGGATGACTTTAGTATCGGCAGGCCTCGACGTGCTGTGGTGGCGACCGCAGAAGCAACGACTGGGGGCGCCACGAGTGTCCGCGATCTCGG
AACTGAAGGATTTTTCGGGGAAAtacaacgacgacgatcgCGCCAGGAATTGATTCGGCAAAGTGAAGTCGGCGTTCATCCGTGATCAGGCTCCAGACAG
CGATAAGTGCTTGGTCTTCGTCGATCTGCTCACGGGACCAGCCCGCAACTGGTACCGGCAGTTGAGTCGGACAACGCAATGCACCTGGAAGAGTGTGCTC
GAAGATTTCTGATCTAATATTGTGGAAGTGGATTGTCTGTCGCGAAACAGTACTACCACACAAGGAAGCAATAGGAGGAAGTACCACGCTAGTATCTCCA
CTGACTGAACGTTGCTGGAATGCGAACAAAGCTCCCGATCAAGAATGGATCGCCGAACGCTCGCCGGGAACACGTCGAACACTTCATTGAGATGTTGGGC
GATCGTGACCTGGCGGATCAGCTGGTGCTAAAACCTGCCAGGGGAAGGCAGCGGCCGGATCGAGCAAGTTCCGCCAGAAGGCTGCACCGCCACATCACTC
GGCTCTCTCGAAACCAGCTCGTGCGGTTAGAGCGATCCATTCGATGGAAGACCTCAGCGAGTCTAAGTCGGAAGTCAGTGGGTTGGAACCGGAAGGTGAT
CTGCGTCCGATCTACCTTGCCGTGAAAGCTGATTGCCAGAATCAAGGCAACTCGCAGTCACCACACCAAGGGGTTGCGGGACCGCAGGATCGATCGGACA
CGAACTTCCAGCCGATGCAATGTTCACACTGTGGGTCCAAGAAGCATGACGACTtgaactgctggaagagacTGACTTGAGCGAAGTGCGGCAGGAAGGG
TCACCGATCCGACCACTGCTTGTTCGTGTGCCGTGCATGTGGCCAGCTGCATGAAGTCGGCAAGTGCCCGATGGAGGAGTTCTACAACTTGATCCGCCAA
TGGTACAACCCCAGCAAGCATACCGGGGTGTTGCCAGTCAACGCGGAGAAGATGTGAAACTAGGACGTTCGTCGGGTTTGAATCCCATACGAGCCGATCG
TGCTAGGTATTGCATTTTTACATTCATGGACAAGACATCCGTAGATCGAGTTAGCAAGCGGCCCGATCGACACGGTAATACATGTGACCTGCATGAGAAA
CGTACCGTGGCGATCTCAAGCCTGCGGCTGGAGGATAAGTTGTCCAGGTCCGATGTCAAGGTAGCCTTGGATCTCCAACTCGGGGATCAGCGAGGTTACT
GGAAACAACAGGATCCGGAACAGTGATTCGCCCCtgtcaagaaggaggacacGTCGGATGTCCAAGCATTCGACAGGACAAGacagcttggcgatctggG
GGCGAGACGCTTCCTGATCTGCGGCCCGGGGAATCACGAGGGTACATGCCCCTGGGAAGTGATTCTAGCAAGCCAAAGCTGTCGCCAAGGTGAACAATGA
AAAGGCCACGTTGCTCTTCGGCACCGGCGCTGAAGTCTCAATCATAGACACCACCTTTGTTCGTAAGGCGGGGTGTATCATAGACGAAAGTCAGAGACAA
GAATGCGTTGGGATCGGGAGAACACCTACATGACGGTTGGACGTACCACGATCAAGGCCACGCTGGCTGGGTCGTTGGTGCATTACTTCGACACTTGGGT
TGGCGATCAGTCGGGGCAGGAAGCGATACTCGCCATGGACTTCATGGTACCAGCCGGAGTCCGCCTCGATCTGGCCGATGGGACGTTTTGTCTCACTGAT
GAGGTGCAGATTCAGCTGCTAGGACGGCGTACACTGTACGGAGCTAATGTCCAGCCCGTCACGCTTGATCAAGACCTTGAAGTGCCATTCGACGAGTCCG
TGGAGGTCCCGATCCGATATGGCCGATCGGCCACCGCAAGGCTCTGGGTCACTCGGGGTCCAAGGTGGATGCCGACCGCTGTCAAGGGTCTAGGCCGGAC
GAGGTATATGTGGATCACAAACGTGAGTGAAGAGAGGTTAGTGCTCGATCGAGACGAACGTTTGGGAATCTGGTTAGCCCCAGACGTCGTACCTCGCATG
TCAGAGTTTGTGTCAGTCGGATCGCGCAGATATGCTGCATGGCAGAACCTCGCGTTCGAAGCTACCACTGAGCGACAGGGGAAACCAGGACCCGAAGAAG
AGCCAGTGGGACCGCTGGTAGATCGGCCTCGATATCCGATGCCGACGCGAATTCTGAGTCGGTCGGATGGGCCTCCTAAACCGGTGGTGGCCGCAGCCAC
TGGCCTACCATCGCCCTGCGAAGGACCACGGGAAGGCCTTCCGAAAGCCGAGGTGAAGCGTGACGAACCGAACGAAGAGCAAGTCGCCCGGGAGCCTACA
CCGATCCAGAAAGAAGAGTCGACCGAGTCAAGACAAGATCTGCCAAAGATCGAAGTCGATCCTTCACTGGAGTCGAACTCGTATGAATCTAATGCAGAAC
AGGTCTGCTACCATGAGGGCGGAGGGATGTTCGCAGAGATTCTCGAACGGAATTTGGTCATCTTGCCCAAGGTAGCCAGTTCGACCAAAGAGGTAACCAT
CAAAGACATTCATGTCGGCGATCTCGACCTGAATACCCCGGAATAGATCGATCGGCTGCGACGGATCATCTGACGAAGGCGGCACCTGCTGATCGGCAAA
GGGAACGCCCTGCCACCTGCGGCACGCGGTGCAGTgtgcgacatcgacgtcggTGGTGCCACTCCAGTACCCCAGCGTGTGCGACCAGTTGCTCAACAAT
TTCGAGAGAAGTTGGCTGCGCTCATCAAGGGTCTGCTGTCGGCTAGGATCATCAAGCACCCGACCTCACCGTGGGCATCCCCGATCGTGATcatcgtcaa
gaagaccGGCGTTGATATTCGACTCTGCATCGATTAGAGAGTCGTCAACGGCCTGACGCGCTTGATGGCATATCCAATGCCGCTGATCAGCAATCTTTTG
GAAGATTTGGACAAGATGCTTTGGTACCGCTCTCTCGACATGGCGAGTAGATTCTGGGTGGTCACCATGACCGAGCGAGCGCGGCTGATCTCAGCGTTCA
TCACCCCATTCGAGCTTTTGGAGTGGCTGTGTATGCCATTCGGATTGAAGAACGCACCTCCGATCTATCAGCGGCTCATCGACAGTGCTCTGTACGGACA
CTTGAAGATCAGTGCGGATCCAGACTTGAAGGAGACGAGTGACGTCTTCGAGAGTGGCGAACCTGACACCGATCAGAAGCCGTCCGTCCTGGGGCAATGA
TCGTACATCTACGACATCTTGGTGACCGCCGATTCTCGGGACACCCTCTGCACAAAAGTAGATCGTCTGTTGGACGCTTGCGAATAGTGGAACCTCTCAA
TCAGCGCGGTCAAGAGCGTCTGGGGACGTCAGAAGGTCGATTACCTGGGTCATCAGGTGTCGGCAAACGGGCTGGAGGCTCACCCCAAGGACCTCGACTC
CCTGGTCAATCTTCCGTTCCCACGCACGCTACGATCAATGCAGTCTTTCTTGGGCAGCTTGAACTACTACAGCCGCTTCATAGAGGGCTTCGCGGTCTAC
GCTGCGATCTTGTCTAGCTGCAAGAGGTGGATTTCCACGAATTCCGCGGACGAGACGAGGTTGTTACTGAAAGTCGAGAGACAGGAGGGCACTGCGTTGC
CACCTGAGGAGGACGATCGCTGCGTGAGAGCCACGGTCGCGCCCACgttgctgaaggcgaagatcGCATCCACGCCGATACTTCGTCACTTCGATCCGAT
CGGACCCTAGTCGTAGTGTTGTACGCCAGTAAATGGGCGATCTCCGCGGGGCTGATACAGGAACACGACGGTGTGTGCTAGCCGGTGACTTTCACTAGCC
GTACTCTGAAGGCGAACGAGATCAACTACGGGATGGTCGACAAAGAGGTGTTAGCCCTCCCCCAAGTCTTGAACGTCTGGTACACGTTGCTCGTAACACG
GTCGATCAAGGTGTTGACTCGCCACTCGACACTGGCATGGCTGGTGAACTCATCTGGACTGGACGGTAGACTTGGTCGTTAGGCTGCGCAGCTTTCCGAA
TGGACACTTGAGATCCGAAAGTGTACGAAGGGAGAGGACGAAATCCTTGGCACGATCGCTGCAAGTATCACGCCTCGATCGGAAGTCGCGGTCGCACCGA
AGAAACAACCTCGCCAATCGGTCACAATGTTGCCACCGACAGTCGATCAGGATGAGAGCCTGTTAGTGGTCAGCTTTGATGGGTCGGCGACTGTCAAACG
AAAGGCCGGGGCTTACAGTGCGATCGTGTGGAAACTCCCCGATTGGACGATCCTCGCCGCAGCGTCGGAATATGTGGCTGCCCTGACGGTCAACGAAGCC
GAGTACCGAGGGTTTCGATCTCCTGTCCGATCTGGACAGGGGGCGACTGACCATCTGTGGAGACTCCAACTTGATGATCAGACAGATGCGCGGTGAAATC
GATTGCAAGGCACCTGGTCTGCAACTGCTCCGACAGAAGGCCCTGCAGAAGCTTAGATCATAGCCAAAGCATGAGCGCTTGCACATGAGACGCGACTGGA
ATCAGAGCGCCGATCGGTTAGCAAGTGCCGCGTTACAATatcaagaaggcgcagtAGTTAGCTTAGAGGAAGATCGTCAGGACTTGATGACGCTCAACag
gctggacgagctgctgaggcCAAAGGCGGCTGATGCCGTTGTCCGCGTGACTGCTGTCACTAgatcgacaagaagaagacctCAACAGCCCGAAGTCCTG
CAAGAAACAATCGTGCAACGCATGAGAGGTGAGCATATTGCCCAAGCTCAGAACGAGGAGAAGTGGATCGCAGACCTGAAGGCGTATCTTCGGGGCGACG
GAGCCGATCTTAGCACCACTGAAGCCAAGTCCAACGCCAAGATCGCGAGCGACTACGATCTGGAtgagaacgagctgctgttcttgcgTCCGGTGGCTAA
GCAAGCTGTTGAAGATCGGGACTCGATCGCGCGGCTGGTGGTACATGACACGTTGCAACAATGCTTCCTCCATCACTCCCTTGCTAGCTTGGAAGGCGGG
CACCAAGGTATCGGGAGGACTTACCAGCGGATCAGGAAGCACTTCC