Description :
From Genome Similarity Track
Location :
Scaffold_3204:289- 2460
Transcript NameFunction/comments
Phyin_T30-4PITG_22450Putative uncharacterized protein

Sequence
2171 bases(100 bases per row)
GCAACACCACATTCGGTTGCGCAGAGGGCAGCGTCCATCCATGGTCAGGTAATAGACAAGTAACTCGCGAATATTTTGCAATGCCCCGACGTCGTGAAGC
TCAACGTGAGCTTGCCGACGACGCCGGGGGTGGCGAACTCAGGCTCCAGCGCTTTGCGGCCTTTGAAGCTGCCGGCGACGATCTTGCGGTGCCGTCGCGC
GAGTTGAAGATGTGCGCCCCGCTCTTGCTCACCGGCATCCTCGTGCGAAGAACCTCCCAGTCGCTTCATGATCTTCCGAGTCTAACGCAACGGAGGAAAA
TCCAGGTGGAAGAGCGGCACTATCATTAGAAGCGTTTCTAAGTGAGTGTAAGTCATTACGACAACTTGCTGTCCAAACAACCTTCAACCAGCGACATGGG
CATCACCGAGATAACAAGCAGACGCAAGTTATCCATCGCATCGTAGCGAGCGATGCATTACAACGCATGAAGAAGACTGGAGGAGTCCTCCGACAGTGAC
GTATTCCAAGCCTTTATCTGCGATACATTTCTCCTAATGATCGTCCAAGTGCGTAATCCCCGTGCAACGTAGCTTTCATTATGAAATCGGCTTTGGAAGG
AGTATTTCTTGACGGAAGTAATTTCGAAAAGCTGAAGCTAGTCACAGGTAGCAAAAATAATGACACATTATTAATTCTAATAAATCTAAGAGGTTTCAAC
GGGGTATAATTAGGCACACTCTGCATTTTTGGCCCGTTTTCGATCGCTGTCACATTCAAACAGCAGGCCAAGTGCCCAAGTTCAGCGCCGTTCCACACAC
GGAAGAGGAGGGCAAGTCGCGCCACTCGATAACCAGCCCGGCAACACGCAGCGTAACAGCTCCGAGGTATGTCGACGACGCAAAAAAACTCAGTGAAAAT
GCTCCTACAACCTACAGGCTTAAAAACTCACCTTCTTCTAATGATGTATAGTTCCAACCAATCAGCAACTTAATCGAAAATGGGCAGGCGCTGGCAACTC
CGTGACAAGGAGAACTTCATCAACTATGTGAAGATCGAGCTGCAGCTTCTGGCGCGGGAGTGGAAGATCATCCTTCCGTGCGTCTTCATGCAGTACGCCC
ACGCCATCTTCCACAACCTGGCGTACTATATCCAGGCCCATTACCTCTCGACGGAGCAGCGCTTTACGCTCCACGACTTGGGTTACGAACTCATGGGCGA
GTTGACGGGCTGGGCCTCGGACCTCTCGGACATCCTCGTGTTCACCACGATCTTCGCCCCAGCCATCGCTCTGGTGCTGACGATCCCGCTCTTCCGACAG
GAGCCTGGCCGCCCGCGGTACCTTGTGATCACGCTCAAGCGCTGTCTGCTGCAACTCAGTATCTGTCTGGTCTTCCGCTGCATTTCGTTCCTCGTGACGG
CTCTTCCGGGCCCTGCTGACCACTGCGAACTCAAGTTTAACGACACGTGCTTGGCGGCGAACCCGGACGATCCGGTGCCTTGCGTTGTCCCCAACCCGGA
GTTTACCCCACCCACCATTGGCGAGCTCTTCACACGTCTGGACTCGCTCAACGGCTGCGGTGACTTGATGTTCAGTTCCCACACGATCTACACGGTGTCA
TTCATCCTAACGGTCTGGAAGTACTGGCCTAACAAGTACGGAATCTCCATCATGGTTCTCGTGCAGATTACTATCGCGTTCCTCATTGTGGCCTCGCGCA
AACACTACACGCTTGACGTGTTCTCTGCGCTGTACATTGTGCCGCTCTTCTGGCTCGCACTGGAGGCGTACCACAAGGACATTAACAACAAGGACACAGA
GGTCACGGTCAAGACCATCTACGACTTTTACGGCATTGACGTCTCGAGTGACGCTAACGACGGCGCTGTGCCTCTTAACACTACGGATGTTTTACCTCCG
CAGGCCGCTCCGCTTAACTCGGTGCAGGTGGCCCTGACGGAAGACGAAAGCCTGAGTGGCGAGCGATTGGATCCCGACACTAGCTTCCAGCGCAAGAATT
CTGTGTAAGGTAGATGGAATACTTTCATTTGGACTTCAACTATAATAGGGACGTATGATCGGCCTGCGTACACTTTTTTTTTTCTCTCGCATGATGGCTT
GTTGCAATTGGTGTTTATAAAGCTGCAATTATTGCCTGCTAATTCTCCAAACCAAAATAAAGAACTGAGCT