Description :
From Genome Similarity Track
Location :
Scaffold_126:289- 1721
Sequence
1432 bases(100 bases per row)
AGTGGTACGATTTACAATCAAATGAAATCTGTCTGAGTGGGATCGTTACGCAAAGCGGCGGTACTGAAACATAGTTTCCGGATCATGAAAGAATCAACAC
CATTAACTATAAAAAAAAAAGCTAGGCCTGCTATGGGCTCGGAGAGAATCGTCGTCTTAAAACACTAAAAGTCAGTCTCTAAGGAAGTAGACAACCCAGG
TTAGCGAGTGTGTGTACAACCAAATGAAATGTTCCTGTCTGAGTGGGATCATTGCCCGAAACAGAACAAATAAAACCCAATTTCTGAATGTGAAAGAGTC
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCACATCAATATGGCAATTTTGTAGTTTTATTCGAAAGGTACCATTGCCTTAAAAGCAAATATGGATAAATCTCAGAGCGGTAATTGTCTTAAAGTGG
TTATCCACTACGTCGTTGTCCTTAAGCTCACAATTCAACACGATTTGCTCATGTTCTGTGATGCAGACAGAATCGCGACTGTTACTTCGTTACAAAACCA
GTTATTGTGAATTCCGTCCAATTTTTACCACTTTTGCCATTAAACTGGTAAATACCAGTGGTATAAACTGCCCAAAACGGTATTTACCATTTGTGGCTGG
TAAATACCGGCTATATTGCCAACGCTAATCGCCATCATACAAATCCAAGTCATTAGGAAGTCTTTTCTTACCACATGTCATGATCTTATTTCGTACTTAA
ACGGGTCAGTATACGGTATTGGACACGCTGGGCGATTTGGGGGTTCATTCAAAGAACCGCCCATGGAAATTTTGAGTAGAACTCACAATACTGGGTAACG
ATATCTGTGACGTGTACGAACAGCAAAATTATTCTTAGTTCAGATACGTTCCAAGAACAAGTTATTAAAGGTAATGATGACAGTAAAACATGTAGTTAAT
ACGATTACGCATCATGTTATTAACATGTAAAGCAACGCCATGGGTTGATTGAGCAAATATTGGTATAAGAAGACGAACATTTAAATTTTTGTTTAGTAAA
CAAGGATGATTATATTTTGTTGTTGTAAATAAAGATGCCGTTTTGGAACAATGGTAAAGAATTATTTTCTGAATTACGAAAGAATCAACAGCATTACTAC
AGGACAAGATGGGCCTGTTTTGGGTTCGACGAAAAATTTTCCTGTATAAAACAATAGGATTCTCTACGAACAATATGAACATCGTTTTAAAAACCCCAGA
ATGACTAGTTTGGAGGGATTAAGTGCGGTAGCACCAACATCAATTAGTATCTATGCACTTCAAACAGATAGTCGAGCTCTGGGTCACTACTGTGGTGATG
GTCCAGAAAGGTAGAACGATAAGTCATAGCTG