Description :
From Genome Similarity Track
Location :
Scaffold_688:289- 1655
Transcript NameFunction/comments
Phyag_g7493hypothetical protein PHYSODRAFT_284160
Phyag_g7494hypothetical protein PHYSODRAFT_554264

Sequence
1366 bases(100 bases per row)
CTATGTCGCACCGCAAGAAAgtgttgctgaagttgatcATCCTGGGCGACAGCGGGTACGTCAATTCGCTCCACAACAGTCAATACACGCCTCTCACTTA
TTTTATTCCTCTGAATATTTTTTTCTTTTACTACTTTTGTGGCTCTGCAGTGTGGGGAAAACGTCGCTCATGAATCAGTACGTGAACCAGAAGTTCAGCA
ATCAGTACAAGGCCACGATCGGCGCCGACTTCCTCACGAAGGAGATtatgctggacgacaagttggtgacgatgcAGATCTGGGACACGGCGGGGCAGGA
GCGCTTCCAGAGTCTGGGGGTGGCTTTCTATCGCGGAGCAGACGCGTGCGTGCTGGTCTACGACATCACGAACCCCAAGGTCGGCAAAGATGCACTTATA
TTTGTTGGGGGAAGTGCTGAGGCTGATGTTGTTGACGTTTATTGCAGTCTTTTGAGAAGTTGGATACGTGGAGGGACGAGTTTTTGGCGCAGGCAGGGCC
GAGGGACCCCGACGCCTTCCCGTTTATTGTGCTGGGCAACAAGGTGGACAAGGAGTCGGAGAGAAGAGTGAGAAGTGGCCGAGGTTGGGTTGATACTATA
AGAGGAGGGATGCTAAATGGGTGAATCGCATTTTGATACAGGTtcagaaggagaaggcgcagcAGTGGTGCCGTAGTAAGAACGCTCAGCAGCCGATTCA
GCATTATGAGACGAGCGCCAAGGAGGCGACGAGTGTGGAGGAAGCTTTCCAGACGATCGCCAGCTCGGCTTTGCAAAAgggccaagaagatgacaTGTAC
GTGGACATTTCATCTAGAAGTCTACTCATTGGTGAATTGATTCACTGATATATTGTTTGTTGTAGCTACGTTCCGGAGACAATTGATCTTAGTGGCACAG
CGTCCAAGCGCGagagctcttcttgctgctaAATTGTAGCTTGTGCTACTGTCATCTGTCATGGGACTTTTCGACGGTAGTGTGTGTTGCGTGCTTCGCG
AGACGGCAGGGAGGGTAAAGAGGGGCAAGCCTTGGTAGACGAACGTTGGCAGGACGAGAAATTCATTTGTCGGTTTTCTTTTTCCAAGCTTTCAGTACGG
AACCTCGCATGTTTGCCGCAGGCGGcacttttgttgctgcatcagGTGAGGCTTGCTCTACTGCCGTCTTCGTTGTACCCCTCAAGGTTCCAAGCGAAAA
TGAGGGCACACTGAtccccttcttcttcgtctttttcttctgcttcttcgctgctaggcgttcttcttctaaCTGCTGACGTCTAGCTTCAATCCGCTTT
TGCACGACACGCCTTCGCCACCGACAGAAAAGCATGAGCTGAGCCGCCAGCTCGACGGCCTCCTCC