Description :
From Genome Similarity Track
Location :
Scaffold_1433:289- 1416
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1433-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1127 bases(100 bases per row)
TGTCTAGGATCCCGAACAGCATGCTCTTGAGGTGCTTCCGGTGCACGTAGTTGGGCAGCTCGAGCTTGTTGAAGCACGGTTGGCCGCGCATCAAGCGGCC
CACCGCGAGCTCATTCCCAATGATCGTGAATGGCGCGACGTCGCCGTTGTAGTTCGTGAGCGCCGCGAACCCGCCGATAGGCACGCGCGTGTTGCCCGTC
GTGAAATGCAGTAGCCGCTTCTTGTACTCGAGAGGCATCTTGCGGACGTACTTCCAGAACCAGTTCATACACGGGTGGCCGTGGATGCACTCGTTGTACT
TGGAGTTGATGCGCCAGTCGTGCGTGTTAATCACATCAGAGCCACACATGATGAAATCGAATTCCTCCGGATCCAACATCATCAGCATCTCTTGTGGCAC
GACTTCGTAAATGCCTTTGAGGAGCGCGTACAATTGCGATGACACGCTCTCAAAAAGCGTATACTTGAAACGACGGTCCAGGTACTCAAACTTGTTGGCA
TCCGTCACGGCAATGTTGCGGCCATCCGGGATCAAGTCAACCACCACTATTTCGCCATTCACCTTTTCTGTCACACTAAAGTCCAAACTCAGTGACTCGA
CGCCCGTGTTGTTTGCCAGGTATTCAAGGCTCTTGTAGGCCTCTGGGTCAAAGAACGCCAAGTCCATGAAGCTCACCGGCAGACCGAGGATGATCTTCAA
CAGCGGCATCGCCAGATGAAAACCCCACAGCTCTCCATCCAGTAACCCACGACCGAGTAGTCGACCAGCAGCATAGTAGTATGTCAGGTGATCGTCGCCG
ATAGCGAATTTTGAGTTTGAATTCAGGTAGTACGTCTGCTCCGAGTTGTTGACGACCTTGAAGAGTCCAGTGCTCGGGTTTGTCAACAGTTCATTCAATT
GCGCGATCCACTCGCGGTTTTGCTTGCCGACAGGGGCACGCGGACTGTTGAGGAATTTGAGCGTCACCTCCGAACGCGCATATTTGACGTCCATGCAGCT
CACGTGCTCCAACGACTGTTCCAACACATAGTCACGATTCAGCGTCAGTTGCAGCTGGATCTTCTTTGTGGGTTCCAATGCCGCGACAGCCTTGACCACG
AACGCAGCGTACTTGGCTGGGAAGTCG