Description :
From Genome Similarity Track
Location :
Scaffold_166:28895- 31148
Transcript NameFunction/comments
Hyaar_Emoy2900073HaRxL83

Sequence
2253 bases(100 bases per row)
CGGAACGCGAGGGTGGGGGAGACCGTTTACGTAGAAAGGAGTATAGCATGTAGAGGCATGAACAGCGTTGTTCAACGCAAATTCAACAACAGAGAGCATG
GAGCTCCAACGCATAGGCGTATCAGCGCAAACACTGCGCAAAATGTCATTAATGACGCAATTAATACGCTCAGTTTGACCATCGGTCCGCGGATGATCCG
CTGTGCACATGTCCAAACGGTGCGGAGCACCTTGAAGATGGACTTCCAAAACTTCCCAGTGAAGCGGGGATCTCTATCAGAGACAATTGCCACTGGCAAA
CCATGTTGTCGAAACACACGGTCGATAGACAGCTTCGATGTGCCTTCGGCATCAATAGAATCCGGCACTGCCGCTAGATGAGCCATCTTGCCCAATCGGT
CATCAAAGACCACAATGCCAGTGTTGTCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCACACTCATGGACTCCCAACACCCAGTGGGTACAGGCAG
ACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGGGTTAACCGTTGACACGTTTCCACGTACGCACATAGGTGCTCATCCACTGTATAGTTGGGGCCACCAA
TAAGCCTGGCCCACTAAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAGGATTCGATACTTCAACTCCTCAT
CATGAGGGACAGCGATACAAGAGTTATCCTCAATATCTGTGCGATATCACAACAGGACATTATCGATAGAACATCGATGCAGCCTCGCACGTAAACGTGC
CGACAATTCTATGTCCGAGTCTTTAAACTCCTTGCTCCCAAGAGCACGTAGCAAAGCTACACATCAATGGTGTAAGCCGCCCGGATTAAGTCAGTGACTG
ACGATGATAGCGTAGTGACGTGAGCAAGCTCATATTCAGGTCGGTGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCGAA
GTTATATTCGGCAAAGAGTGAAAGCCAACGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCGCGGTGCGAAGTGATGCATGATCTGTATAGATCACA
AATGGCTTTGAGGCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAGCAGGTAGCTCTTTGTCATGAACGGGATAGTTCTTTTCAGCAGCTT
TGAGCTGTCGAGATTCGAATGCAATGACGCGGTCGCGTCCATCGACATCTGTTTGTAACAGAGCATTTCCTATGGCAAATTCAGATGCGTCACAGACGAC
ACTGAAAGGCCTATCAGGATCGGGCAAAGCCAGTATTGGTGCATGCTGGAGACTTTCCTTAACTGCTTGAAAAAGCATCATGTTCGGTGTTACCCCAACA
CCAATCCACATCCTTCTTAAGGAGATTGGATAATGGCCGAGCCATATCTACGTAATTCGCACTGTACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTA
CGTAGATCTTTTGGTTCTTTGGAACCGGCCAATCGACTATGGCCCTTACCTTAGCGGGGTCCGCTCGGAGGCCTCGCTTCCCAATGAAGCATCCCAGAAA
GGGAATCTATTCTGCACCAAACATGCACTTAGATATTTGTATAAAATTTATTCGTGCGCATGCACTCGAGCACCGCTCGTAAATGATCAATGTGATTATC
CACATCAGATCGATCGTTTGTTGCATGACTATGGACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAGGTCTAAATAATTGCGTCACCAGA
TGATTAAAAGTAGCCGGGGCATTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGCGGTTAGCGGAATATAGC
TTGCACGCATGAGCAGCTGGTAATACCCATCGACTAAGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTCCTGAAGAGCATCTTTTCTGGGGAT
TGGTGTCTGAGCCGGGATAGTGGCAGCATTAAGCATGGACAATGCGCCACTTATTATCTGGCTTCTTGACACAAAATATAGGTGTGGAATGGGGAGATTT
ACTCTCACGCACCATTCCAGCCGCGTGCTTTGCACGAAAGAAATCGTCAATGACGTCACACTGTTCCTTAGGTAAATGCCACGGCCGTGTTACGCAGTAT
TTAGTTCCTGGAACTAGGTCCATTTCATGACGTACACCTCTATCGGGAGGTAA