Description :
From Genome Similarity Track
Location :
Scaffold_50:28891- 31229
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013416Similar to MRPS26: 28S ribosomal protein S26%2C mitochondrial (Bos taurus)
Pytul_DAOMBR144PYU1_G013415Similar to ATPK19: Serine/threonine-protein kinase AtPK19 (Arabidopsis thaliana)

Sequence
2338 bases(100 bases per row)
TCCGCGCTTCACGCACAAGCACCTTCTCTTCAAAGTACTGTCTGACCTTCTCCTCGTGGAGCGCCTTCTCGCGCGCGACTTCCTCTGCTCGGATCGCCTG
CTGCTGGCGCTTGATCTCCAAACGCGCAGCCTTCTCCTTCATGATCTTCAATCGCTGCGCTCTATAGACAAGTAGTTATTCACAACACGCTTAGCTACAT
GCGCGTCATAGGGAGGGAGGGGGCAAAAAGAAACACGCAGCAACGTACTCGGCATCACGCGCGAGCTTCTCCTTGCGGCGCGCGACTTCGGTGATGAACT
CCTGGCGGAGCGCGGCCACTTCGGCGCGATACGCGGTGCGGGACTTGACGAACGAGTACGAGCCATCGGCGTTCGACACCGACGCCTGAGTCGCAATCTG
CGCAAAAGGAGAAGAAAAAAATGTGCAACAGGTGACAGATCCACAGCAATGTGGTGAGTGACGACGTATCCACAGCGCGCATTGAGAAAGACGCGCATAG
ATGCACTCGCAACGTGCGGGAGCGGGACGTACCGTGCGGGCGAGGACGGCGCCCTGCTTGGACGCAGCAGCGACGGTCGTGCGCGCGAGCATCCTGGTCT
TCGTTCTGGGCGTCACTGAGCAATGAACCATGCGCTTGTTCCAGCCACTGCTCGTATATGCGGGCAGCGATTCAAAAATGAATTGGTGGCAACTAAGTAA
CGTGAACCACATAAAATAAATAATTTACTGCCAAATCAGGACACTCTTATGTATCTATTGGTAATTAAAGGTACTAGTGAGTATAAGAGGAACGCTTGTG
CTTGTTGTATACAACAAAAAGGGTGCATTTTATGTACATTGTGCTAAAATTGATAGCGTTTGCTTTAATGAGGACCCATTCCTAGTGTGCATCAGCTCAC
TATATAATCAAATATAATGTGGGCCACCTTATGTTTGATGCTGACGCAGTCGTTTCGGTTTGTCGTCATAGATGTTGAAAATGGAAAATGGGAGTCGTCC
TACTTGCCCTCGTGCACCTCTGTCTCTGTGTGTACCTGCCGCCTGCCCGTCTGCCTCTAAAAGCAGCAGTTGGTTTCACGTCCAAGAAGCGTAAATAAAG
ACGCCGCGATCGTCGCTGCAACCTACTACCGCGGTGTTTTCCACCTCCCTCCCGATGTTGCGTCTCGTCATCCGGTCCGGAGGAGTCACAGCAGCACATT
AAACGGCATCCGAAAAAAAAATAAAACAAAGAAACAGCATCGCATCACGCGCAACGCAAACGACGACGCGGGTGCGGGGCGCGGCTGAGGAGACCAAAGC
ACGCCATCCCTGGTGGTTAGTTCGATTCACACAAAGCAGCAATGGGCGCGGGCGCATCTGTGGAGGCGCAGGCGGCGGCCAAGATGCAGACGCGGTCGCG
CATCGTGACGGCGTTCCTAAACCTCGCGACCAAACCGCACCACGCGCCACTCGTGGCCGCCAAGACCCAGTGGCGGATAGCAGCACCGTACGCCGGCACG
GGCTCCGAGCCGTCCACGAACGAAGAGGAGCTGCTCAACATGCTGCACGACCCCGTGGGGCAGAAGCACATTGGCGCGTTCGCCAAGAAGATCATGACGG
CCGAGACGTTCTTCTGCTGGGTTGAGGTCAAGGAGTTCAAGGACGCACCATCTATCGGCTACCGCAAGTCTCTCGCCAAGCTTATCTACAAGAAATACAT
CAAGAACGGCTCGACCATGGCGCTCGGGAGCATCACGTCCGAGCTCATCGCCACGTATGACGTACGTGCCTCGTGCGAGTAGCGTTCTACCTGGGTGCGT
ATTGGTATTGCTGTGAATTGGCTCAACCTCTGTATGGTTTGTGCTTCTGATAGAAAAAAATCACCGACATGGAGACGAACCCGAGCCTGATGACACCCGA
ATTTTTCGATCCGCTGATGACGAATATCGTGAATGACATGTGCCAGAACACGTTCTTGCGGTTCAAGACGACGCCTGAGTACGATGCGTACAAAAAAGAC
GTCAAGGACACGTACAACAAGGTCACGGTCGAGGACTTTGAGTACCTGGAGCTGCTCGGCAGCGGTGGCTTTGGCCGCGTCGTGCACGCGCGCAAGAAAT
CCACGGGCAAGCATTATGGTACGGCTCTACCTTGATTGTCTCTCTCTCTCTCCCTTGACGCTTTTCTAATGCCATTTCGTGCGTTGTAGCTATTAAAATT
CAGTTGAAGGCTGGTTTGTTGGACGAGCACCACGATCAGCTGGGTCAGATCACGTCCGAGAAGGACATTCTCCAGGTGTGCCACAATCCGTTCATCCTGG
ACATGCAGTATAGTTTCCAGACCCCGGCGCACGCGATC