Description :
From Genome Similarity Track
Location :
Scaffold_120:28872- 30695
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_120-snap-gene-0.28Heat shock protein 70
Pytir_DAOMBR486maker-pir_contig_120-snap-gene-0.18(Fragment)
Pytir_DAOMBR486maker-pir_contig_120-snap-gene-0.19Tyrosine protein kinase

Sequence
1823 bases(100 bases per row)
GTCGCCCGCGTACATCTTCTGCAAGATCGGATTCGCGACACCCTCCAACTCCTTCTGCTTGGCGTCAAACTCCTCCTTCTCGGCCGCCTGGTTGGCATCC
AGCCACGCAATCGTCTCGGTAATCTTGTCGTCCACGCGCTTCTTGTCGTCCGCCGAGAGCTTCGCCTGGATCTTCTCCTCCTGGAGCGAGTTGCGCAGCC
CGTACGCGTAGTTCTCAAGCGCGTTCTTGGCCTCGACACGAAGCTTATTGCGCTCGTCGGCGTCCTTGTACTTTTCGGCCTCGGCGACCATGCGGTCAAT
GTCCTCCTGCGAAAGACGGCCCTTATCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCGACCGCCGACACGTTCAGAATCCCGTTCGCG
TCGATATCAAACGTCACGTCGATCTGAGGCACGCCACGCGGCATTGGCGGGATGCCGTCCAAGTTGAATTTGCCCAACGAGTGGTTGTCACGCGTCATCG
TGCGCTCGCCTTCAAACACTTGGATAAGCACACCGGGTTGGTTGTCCGCGTAGGTCGAGAAGGTCTNNNNNNNNNNCGGGATCAGCGTCGTCATCACGCC
GCCAGCCGTCTCGAGCCCCAGCGACAGCGGCGCCACGTCGAGCAGCAGCAAGTCCTGCAGGCGACTCGACTTATCCGCGCCACTCAGGATCGCCGCCTGC
ACGGTCGCGCCAAACGCGACGGCTTCGTCCGGGTTGATCGACTTGTACAGGTCCTTCCCGTTGAAAAAGTCCGAGAGCATCTGCTGCACCTTGGGGATGC
GCGTTGAGCCGCCAACGAGCACGATCTCGTTCACCTGGCGCTTCGAGAGCTTCGCGTCACGGAGCACGCGCTCGACCGGCTCCATGGTCTTGCGAAAGTA
GTCTGCGCACAGATCTTCAAAGCGCGCGCGCGTGATCGTGCTATTGAAGTCAATGCCATCGAACAGCGAGTCGATCTCGATATACGCCTGCGCCGACGAC
GACAGCGTGCGCTTCGCGCGCTCGCAGGCCGTGCGCAGGCGACGCAGTGAGCGTTGGTTCTGCGTCATGTCCTTTTTGAACTTGCGCTTGAACTCGGCCG
TGAAGAACTCGACGAGGCGGTTGTCAAAGTCCTCGCCGCCCAAGTGGGTATCGCCCGCAGTCGCCTTGACCTCGAAGATGCCCTCTTCGATCGTCAGCAG
CGACACGTCGAACGTGCCACCGCCGAGGTCAAAGATAAGCACATTGTGCTCGCCACCCTTCTTGTCGAGCCCATAGGCGATCGCGGCCNNNNNNNNNNGG
CTCGTTGATGATACGCAGCACATTCAAGCCGGCGATGACTCCGGCGTCCTTGGTCGCCTGGCGCTGCGAGTCGTTGAAGTACGCTGGCACCGTGATGACC
GCGTTCTTGACTTGCTTGCCAATGTACGCCTCCGAGATCTCCTTCATCTTGATAAGCACCATCGACGAGATCTCTTCTGGCTGGAACGTTTTGGTCTCGC
CCTTGAACTCCACCGTAATCTGCGGCTTGTCGCCGGCGCCTGGCGACACCTTGAACGGCCAGTGCTTAATGTCGGCCTGCACGATCGGGTCCGAGAACTT
GCGACCGATCAGGCGCTTGGCGTCGAACACAGTGTTGTGCGCGTTCATCGCGACCTGGTTCTTCGCGGCATCACCGATGAGACGCTCCGTGTCCGTGAAC
GCCACGTACGACGGGGTCGTGCGGTTACCCTGGTCGTTCGCAATGATCTCCACGCGGTCGTTCTGCCACACGCCGACGCACGAGTAGGTCGTACCGAGAT
CGATACCGACGGTCTGGCCCGTG