Description :
From Genome Similarity Track
Location :
Scaffold_693:2887- 7873
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_693-snap-gene-0.5Carboxyl-ester lipase

Sequence
4986 bases(100 bases per row)
AAGTCGCTATGCAGGGCTGAAGCAGTCGCGCATCAAGATCTGCAGCAGCTCGTCGCTGCCGAGCGTCGCGCGCAGGTTGATGCAGTAGGCCTCAAAGTGC
TCAAAGCCCACGGCGCCATCGCCATTCCCACTCGAGAGCTCAAAGCTCGCGGCGAACTCCTGGAAGACTGCGGCTGCGGACGCGCCACCGAACTTGACAT
CCGGGTGTTGCTGCGCCTGGAAGCTCTTGGCGAGCGCTACGGGGAACACGCGGCCTTTGCCCGCGCTGGACAGCGCAGTGAACACACGCCGTGCGGCGTC
AGCGCAAGCGGGACTGAGCTTCCCCAAGAGGCAGTGGAAGAGCTTGCGGATCGCCATGCGGCTCGGCAACGCGTGACTGTTCTGGACGAAGCGCGAGCCG
ATCGTGTTGGCTGCTACTGTGGAGCTGTTGCCAGACGCGCTTTGGTCAAACTCGCGCGCCTCGGGAAGCTGGTTGATAAAGCCAAAGAGGGCGATACAGC
TCTCATCGCTGAGCGTGAGTCCCAGTGTGGCGCTGAGGCACTCGCTGCAGTGCAGAGCCGAGATCGTCGCGGTCTTGGCGTCAATGTACTGCAGTGCGCG
CTTGCGCAGCGCTACAATGTCAGCCACGCGCTTCTGGCGCAGGCGGTGGCGGATCGTGTGGAACACCACGTCCCCCTGGATGGACGCTGAGAAAGTTAGA
GTGGACGCTTGAAGAGTTGAGTGTCCACCTGAGGTGGACATCTCCATGGGAGCTGCACTGAACGCCTCCCGCAGTGTCACGATGCGCTTGCCATTAATTG
GCGTTGGTGGATTCACTGGTGGCTCGGTGAGGTTGAGACTCGAGCCAGTCATGCTCAAGACCCGGTGGACACTATTGTCCACCTGTTGGTCCTGCTGCTG
CAATCGCAGTTGGACATCCTGGAGGTTGACGCCGAGGTCGTTCCGGACCTCGCGGACGACGTCCGTGCCGTTCGCGAGCGTCACGAGCACGCGTCTGTTG
GTCGAGTTCTCGCACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCGTCGTCGATGCTCGCGCTCACGTTCTGGTAGTAGTGGAGCCACTG
GGTCCACGTAATCTTGCCGTTGTGCACGCCGTCGACGTCAAAGGTCTCGAGGAACTCGCGGCACACGAGCTCGGCGGTCTTGCGGCCCGAGAGCACATCC
GGATGGCGGCTCGCATCGTAGGTCTCGACGATGTCGCTCGGCTCCAGGAGTCCGTTGCCGTCTTTGTCCATGAGCCGGAAGGCCTCGCGCACAAAGAATA
CGCGGCGCTCAGAGAGTGGGTCGCGCACGCCAGCTAGAAACTCGTTGAGGTCGATGCCGCCGCTCCGGTCGCGATCAAAGTACTGGAAGAGCAGCCGCGC
GTCCGCGTCGCTGAGCTCGAGCTCCATCTCGGCCATGGCTTTCCGAAACTCGCTCACGTTGAGCGAGCCATTGCCGTCGCCATCCATGATGCGGAACTTG
CGGCTGAGGCCGCAGAAGCCGTGTGCACCCTTGGCCTTGAGTGCGGTCTTAAGCCTCGCGATGATCAGCTGCACACCCACGGGGTGCTCGCGTCTGTTGT
TGTCCTGGGACGCACTACTACCAGTTGAATACGAGGACGAGGCTGAGCCTCGTCGGTCCCCGTTAGCTCTGGTCCCAGTTGATTCCATGGCCAGACAGGC
CGAGATCAAGTCGCTCACGTTCCCTCTGGTTCGCCGCGCTGCTAAGTTCGCACTCACCACCACTGCTGGCGCTGGCGATGTGTGGTCGAGAACATCGTAG
AAGCTGGTCCTCGCTGGCCGCTCCCTGCCTCGCTGCTGCATCTGACTGGCCAGCACTCTTGCGACGTCCTCCTTCTTGACGCCAATGTCGTTTCGCACCT
CCTCGACGCTCGACGAGCCGTCGGCGTGGGTCACGAGCACGCGCCGGTTGCTCGAGTTGGCGCTCCAGCCGGCGCCGCCGCTGATGTGCCACGCGTTGCG
CATCATGAGTTCGAAGTAGTCGTCGTCGTCGATGCTCGCGCTGATGTTGGCGTAGTAGCGCGTCCAGGCGTCGAACGATACCTTGCCGTCATGTACGCCG
TCGACGTCGAAGGTCTCGATGAACTCCTGGAACACGTCGTGCTCGGTCTTGCGGCCCGAGAGCACCTCCGGGTGCTTGCGCGCGTCGTACACGTCGACAA
TGTCGCTCACCTCGAGCACGCCGTTGCTGTCGCGGTCGAGAATGTCGAACGCCATGCGCACGAAGAGCATGCGGCGGTCGCTCATCGGCTCGCGCACACC
GGCGAGGAACTCGGTGAAGTCCACAGCGCCGTCGTGGTTCGCGTCAAAGAACTGGAAGAGGCTTGTCGTGTCGCTTGCTGCCAGGTGAAGTTTGCTCTCC
TTAAGTGCGCGCTGGAACTCGTGCAAGCTGATGGACCCGTTCTGGTCATCGTCCATGAGGCGGAACTTGCGCTGCAGTGAGATGAAGCCCACGACGCCCT
GCTCCTTCAGTGCGATTCGCAGCTGCGATAGGATGCGTCTCAGCTCCTTGGTCTGCTTGGCTGTTGAGAAGAGACCTCCAGGATGAGCTCCTGGATTGAC
GGTAAGTGATGTCATGTTGCGGTCCAATAAGTGATGGTGGGTCTGGTGGTGATGGTCACTGAGGTCCGGTTGGAGGATCGCGAATGCCTGGCTGCTGCCG
TGGCCCGAGCCACGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCGCATTGCTGGCCAGTGCCAGGGCCCTGGGTGATGGTGGTCCAGCTCCAGTGCTGGACTGGCTAAAGAGCGGGTCGTCGTCCAGCTGGAGGTGCGAGA
GCTGCCACGTGTTGCGGATCATGAGGTCGAAGAAGTCGTCGTCTGCCACGAAGAAGCTCACATTCTGGTAGTACTGCACCCACTGCGGGAATGCGATCTT
ACCGTCACTCACTGTCGACAAACTCTCGACGTCAAAGCTCTCGAGGAACTCGTGAAAGACGTCCTCTTCGGCCTTGCGGCCCGAGATCACCTCGGGGTGT
CTGCTGGCGTCGTAGGCCTGGACGATCTCGCTCGGGTCGAGCTTCCCGGACGCGTCCCGGTCGATGCTCTCGAAGGCTGCCTGCACGAGCTGGTACCTGC
GGTAGTTCATGGGCTGGCGGATCAGGTCGAGCACACAGTGGAGTGCCACGAGGCCGCGTCGGTCGCGGTCCAAGTGGCTGAAGAGGCAGCGCAGGTCCAC
GCCACTCAAGTGCGCATTGTCCACTGAGCCCAGGGCCGCCTTCTTGAACTCGGCGAGCGTGAGGAAGCCGTCGTTGTCCTCGTCGCTGAGACGGAGCGCC
CGACCGAGTTCGACGAGGCCATGCAAGCCGCGGTCCTTGATGGTCGCCCGCATCCGATTGAGGACTGAGGTCGTGCCGGTGTCCACAGCAGTGGGTCGCG
TCGAGGTAGATGCTGAGGTGGATGCTCCGCCTGTTGAGGAACGTTTCAGTGAGGGGGACGCTTGGCGCATCGATGGGTCCACCATGCACGCGGCGAATTG
CGCGCCCTTGAGGAACTCGTTGGTCGTATGTGCTGCACGGGGCGAGACGCCATCAAGTGATTCGCTACCTGAAGCCACACCAGTGATGCTGTTTGAACGG
TGCAGACGTGACGGAACTGGCGGTGGGAAGGCCGTGGAGACTGAGAGCGATGACGGCGTCTTGCTGTAGGTGGACGCCATGGCCGGGTTGCTTTCCTGCA
AGGCCTGCATGAGCGTCATTGGCGCCGTTGTATCTCCAGCGAGACCTAAGCCTGATGAGCCACTGTAATTGGCGGTGGCTTCGCTGAGCGACGTGTGACT
CGTGGCCTTCCACACGCGCTTCATGAGCAGTTCAAAGTACTCGTCGCTAGGCACGTGGCCGCAGACGTACTGGAAGTAACTCATCCACTGGTACAAATTC
ACAAACGACGTGCCCACGTGGCGCGTCGCGCTCTGGAAAGAGCTCTGGAACTCGGCGTGGACCTGCTCGGCGCTCTTCTCGCCAAACATGACGCTCGGGT
GCCTGGGCGCGTCGTGGCTCGCGACAATGTCGTGGAGCGACAGGTACCCAAGCCGCTTGCGATCGAGCTGCTCAAAGACGCTCTGCACGAGCTCGAGCCG
CCGGCCCGTGAGCGGTCCGCAGATGACGTTCTTGAGCGCATCCGGGGTCACTTTGCCGTGGTCGTCGTGCGTAATGTGCCGCACGATCGCGCGGGCGTCC
TGGGGATAGCATATTAGCATAGCGGAGATAGTTTTAGCCCTAGAGCTGGGTTCTAATGGGGTTTAGTTACGCACCACGTCGGAGATGAGCACGTTGGTGT
CGTGAAAGACGCGCTTGACGCTGCCTTTGCCCAGGCCCGCGTTCTCGCTCTGTGCGAAGGCCTTGTCGAGGTTCAAACCCAGATCCACCCACGTCCTGAG
TGGTCATCATGATGGGTTAAATAAAATAGAGAGACATAACCTAGGGATAAATAAATGCCCAGATCTGTGTGCTTACATGATGCCGCCAGCGCGGAGCGTG
GCGCGGACGGACTCAAGGAGCTTGCTCAGGTCCACCTGCTCGGCGTTCAGCTGCTGCAGGTTGTTCCACTGCGTGAGCGACGTGGG