Description :
From Genome Similarity Track
Location :
Scaffold_992:2887- 3903
Sequence
1016 bases(100 bases per row)
GGCCCCGGATCCTTAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCGCGTC
TCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAG
CAGAACACGGACCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTAGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTAC
ACCACAGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGA
CCTGGACGAGGCCTTTCGAATGATACGACGGATCGAGGCTTTGTTGTCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTAC
CCGGCGTACTCAGCGAACTCGGCGTATGGCGCCGAGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGG
CTTGTGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAGGGGGGGGGGGACTGCGAGTCAGCAACCCCCTG
CGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGG
ACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCTAGCGGTAGGTTCCTCGTGTCTAATAGCACTAAGTCCC
CCACTTTAAATACACTTAAGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTCTATCCTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAAT
GTTCAGCTTGGTATCC