Description :
From Genome Similarity Track
Location :
contig_57:288684- 290123
Transcript NameFunction/comments
g10994.t1POM68382.1 Amino Acid/Auxin Permease (AAAP) Family [Phytophthora palmivora var. palmivora

Sequence
1439 bases(100 bases per row)
TTAGTTGGCCGCGCTGACGTTGTAGTACACCGTGTTCTCGAACTCCGGCGCACAGTACGGGAACTCCGTTTCGTCGTGTGACGGAGCAAACAGCTCCTTG
CCATTCATGTACGTCACGTAGCAGCCCAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGACCTTCTCCCACATCGCAACCTTCTCCCACGACATCT
TGAGGTAGAAGACGATGGGCAGCAAAATGCAGTTCACCGTGATGCACGAAGCGCCGACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGA
AATGATGACAAGCAGCACCACGAGGATGAACCGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGAATCGTCCTTG
TGCACGTTCTCAGCGTCGGCCACCGACACGTACGACATCTTGGAGTTACGGACCACGGCTGGGTCAGCCGGAGTAGTTGTTTGCAGGTAGCTGGTGGCGT
TCTCCAGGTCCCCCTGCTCCGCCTTGTGCATGCCCAGGAACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGATGTG
CAGCTGCATGAAGAGGTAGGCTAGCACGATGGTTCCCCAGTTGGGCGCAAAGCCCAGGTTGGTGAGGCCGGTGTCCGCGTCCGGGTAGATAGTGAAGAGC
AGGTTGCCCGAAATCTGGCATCCCACGGCCGAGTACGCGGTGCTGGCTAGCACCAGGAACAGGATCGAGATGATGCCGACGGTGACGCCCACGACACGCG
GCATGCGCTTGGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATACCAGCCCCGTAGGCGAGCGACAGGTTGCCGAAGCAACCAGCGACCTGCTC
GAACGAAAGGTCAGGCGTCGGCACGCTCGGGTGGCCACTGAGTCCGTGCATGACTACAGCCACGGCGAGGATGTCGGCAATGATCGTTCCCAGGCATCCG
GCGAAGGCGGCGCCAGCTCCTTCCTTGAGGGTGGGCACCAAGCAAACAGGCAGCACCGTGAGCGCCATGAGGATGATCCACGTCGTCTGGCTGAAGGCTC
CCGGGAAGAGGCCGTCCAGCAGCGAACCGCCGAGGACCAGGAAGACGCACGGGAGGAGAAGGCACGAGCCCATTTGCGAGACGATACACAGCCAGCGACC
AATCGGCCCCATGCACCACTGACCGAGGTCTCCAAACGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGGTCATGGACGCGTAGATGTTG
GCGAAGGCCATGAAGGCCATGGCGACAACAGCGAGGAAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCCGTAGATACAGCAGA
AGAGGTTGAAGGCCGACTTGGCGTCCTCCGCGGTGAAGA