Description :
From Genome Similarity Track
Location :
Scaffold_18:288670- 294587
Transcript NameFunction/comments
Hyaar_Emoy2900029HaRxL27
Hyaar_Emoy2803204Sulfate Permease (SulP) Family

Sequence
5917 bases(100 bases per row)
GAAATAGATGGGGCATCACGAATAAGAGGTTCTTCATGCAGGATGAGCTACTGGATCGAGTGAGGATTTTTGTTTTTTACTCTAGATGATGATTCTTCGC
ATCGTAGCGCGCGCTGTTGAAAGCATCGAAATCTACGGACATCTAGTTGTATGCATATTTCGTTTCGATGCATATTTTCACACATTGCCACATGCACACA
GCACCTTTCACGTGATTGCAGCTGAATACTCGACCCAGATCAATTAGTTGTGTCTGACTCTGCCGCGGCTTGTTATCCTGTGTTTGTATGCATGAACAAC
CCACGTGCGCAAACCCAATTATCCGTCGTGCCTTCTTCGACTTTGCATGAGAGTGGTCATTCATGGAAGGCCCCACATGCTAGATTCGGTTCGCTTTATT
TTACATGCAGCAGCAATAAACCCTGTTGAGTCGAAGTGTTGTAGGACAGAGCAGAATACGTTAGATCACATGCGAAAAAAATATGTACGGTTTCATAGCC
TCTGTCTGATCTGCCTACCGTACTGACTTGATGTGTTCAGCATGCGGTAATGAGAAACAGGAGCTACATGCCGGGCGTCATCTAGAATGAAAAAGTGTAT
CCTTTGAGCAAGTACGCGCGCTATGTAGCGACCATCTGCTACAGTGAAAAGCTCGCCCCGGTGGTAATCTTTCATGTCGAAAGTGTCGCTGGAGATGCTA
TACTTGGTGGTGACTCCCAGAAGTGTTTATCACAATTCCCCACTTCCAACTACATCGCACACAGCTCAAGCTAACAGACTTCTTCATCGAACTACAACAT
GAAGCTCGTCTTCTTCGCCGCTCTTTCGATTACTTTTCTTGCGTGCAGCGATGCTGTCGCAGCTGGTGCGGAGCCTAATCAATTCGAGCCATTGTCGAAG
ACCACAGCCTCTCTTCTTCCCGCACGACCCCTCACGTTCGGCGATCTGCCCGCGGAAGACGCACGTGGAGGAAAATCGCTTCGACGCCCCGATTACAAAG
CCGATGAAGCGCCCGTCTTAACCGCTGACACCAACGAAGAGCGACTGTTTGGGACCAGTATAGGGCCAGCTGCGGAAGTGACAGGCTCTCTTATAACGCG
CATCAAGATGTGGGCTAAGAAGTTTCGTGACCGTAGTCGCATTCACCCTTCCTCCACATAGTCGGCTGTCAAAGGGAGACACGCCACTAGATACGGTAGG
CGTGTAGCGTAGACACTAAAAGGGACTAAGAGAGAGCAGTCTAGACAGAAACATAATCCATTTGAATATCAAATTGATTATGTTGCGGTACTCCGACTTC
TGCGGTTCGCACTAGTTGGTGCAGCCCATCAGCCTCGCTTATTTTTGACTCGGCAACGTCAAACTAGAGCCATGGACCGGCCTGAAAAGCAGCGCTGGAG
AGAGTGAAGCAACTAAGTTTTTGACCTGCACCCTATACCTTGGCCTCGTCGTCCTGCTTTGGGCTGGGGATTTACGCTGCAGCTTGAGCTTGAGCTCCTT
TTCGGTGTCGCTTCGTGGCGCGTGCACTTGTCTCAACGATCACGCTGGACAACACGACCAGTGTGCACTTTGTTATGCAGAAGCAACGAGCGAACAAGGC
GGAAAGTCTCGCGCGAGAAACAGCCATTTGGCAATGAACAGATGCACGTCGATCGATTTAGTGTAGTGTTGCAACTTCGAAGTCGTGTGATTGCAAGAAA
TATATCCAGCCAGATAACTAGCTCGGCACAGTCGCGAATAAAGAGTGATTGTAACCCCACTCCAACAATAACGAGGCGAATGACTTCTTTTGATCTGACG
GAGGTTGGACAATACCATACAATCGGTCGTGTTGATTGCCAATTTTCATTCCGCTTGGCTCTTCGTTTTGTCGTTAATAGGTGATATGTAAGACCAGGTG
CGGAAAAGCATCTGGCCTCCAAGAACATTATGGTCGCCCTCTCGTTGTGTCGTTGGCTAGTCAGCGAATTCTTGCCGCTGGCGGCTGGAACATGTAAACG
TGTTTTGAATAGTTGAGTCTCTAATGCTGATAGGGTCTGTCTTCGATACCAATGTGATGGAAGTAGAGTCACTAGTGAGCAGGCTGTCGATACAAGCCCG
CTTCACCTGGACGATGCTCGTAAGTGCCCATCTCGTCTTTGTCCGAGTTACAATCGGTTGCAGTGTACTAAGTGGTACCGTTTCAGCAAACGCGTTCACA
GCGTAAAGTTGGCAACGGATACGCTACTGAAGGGCGGTCAAACTGACAGGTTTTATACGAATGTATGATGTGACACGTCGCGCTTCAATTGATGCTAGAT
ATACGCATGCTGCTGCTAGAATGAGCTCAGTAACGGGTCTGTACCCAAACACCCGGATATGTCAATGGTTAACGCTCATTTTCACCTCAATCGTGTACTC
GTAAGAGACATGCTGGGCCTTTCAAGAACATACGTATTTCGATCCGAGAAGATATGGTCAATATAGAGATTGCATGTTGGTTATTCCTGTGGAGGTTGAT
TATCACACTACAAGATCCTTGGCAATCCGCACTTTGCCGAGAAATCACTTGCTTGACGTGACCGTACGATAATTTGGAGTGGTGCGTTGATCAAGCTGGA
TGAGTTCGGCGCTGACTGTCAGATTTTTCTGGCTCCTTACCTCGTGTGTCAGCCGATTCGTTCCTAATGAATATCGAGGACTGTTGTGCTGTTGTGAGCA
AACAACCCGCGACTACTCTTAAGAAAAGGTTGACACGGTACGGAGACAACTCAATTGATCGAGAAGAATGAGCTCGACTTGTTGCTCTGAAAAGAAGGAA
TATGAGACTTCCTCGACCGCCAAATTACAATTTAACGTGCTTTGCTACAAAAACTCAGTCCAAAACAATTGAGTTTGGTACTCAGTGCTCACAGCAAGAA
ATGGTCAAGGAGCGTAGCAATTACGTCCACCCCCTCTGCTGCGTAGGATGGATGAAGCTTGCATGGCTCGTGCAGTGATCCGCACGAGCCATGCAAGCTT
CATGTCACGCAACGTGACGTCTTTTGCGTTGTCCTTTGAGAAGGTGGGTACGTATAAGATGCACGGACTGCTTACCGAGTAGTCGTAGCAACTTTTTTGG
CGCTCCTACTGCAATCGGTACAGCTGATACACTTATGTGCTTAGCTCGACTTGCATCAATAGTTGCGGACCGCTTGAGCGTGTATGTAGATACACCGGAT
GATCTGTCGGCGTCTACATACTTTATCTAGAATCATTCGTATCATAACCCATCGGGTTGTATTACAATCCCTACTTGCCAGAAAGCGTGGAATCTCATTT
AATCTCCACATGATGATAGGTTCTTCACTCCAGCATCAGGGACTTACTCTGCAGCTTGCCAAATTCACATTGGCTTTCTGTGCACCCTTTCGATCAGGGA
ATAGACTGCAATGAACGCGTGATTGTTGTCGCCTGGAACCATTTGGGTGGGAAACCATATTTATAGAGCCGCGAAAAACGTGGTAGTTGTCAGAAGCACT
TTGTTGCGTCTCGATGGGATTACAATCACAACGTTGTGGCAAGCAGCAGCAGCCCCATACTGCTGAGATTCGGTGCACTTAGAGCAATGTGCTCGATACA
ATCGTATTAGCCTCTAGAACCCCATCCGCCTATTCTTGATCTTCATATGATGTAGGTCTCAAAACAAAAAAAGACGGCATCTGAATCCTACAATTTTTCG
TAACTTGCTCTGACGAAATGCTCTTGGTGTACCCGCCCTAAAGTGCTATCGACGATTACCAAATAACCGATGCCCCTGGGTTGCGCTCGTGATTCCACGA
CTTTTGATTGCATGTACTACGGATGCATTCGTAAGTCTAACCAGCTGTAATGCTGTCGACTTTCATCATTCCATACGAGGGCAAAGCAGCCTGTGCTCCG
GCTCAATGCCGAAACACTTGTATTCGAACCCATTACACACCTCAATAATCATCTTACAAAGACGGCACTCTCCCGACAGCACTAAAAGTACCACTCAAAT
CGTAACAGCTGATGTTATAAACAGGTCAATCAGCTCCTTAAAACCTCACTTGGAGGACATCAGAACTTCCATCCAAGCGATAGACAGACAATATATAGAA
CCGACATAACCAATCATCTGGCTGACTCCAAATATTAAACTAAGTATACCACACCAATTACCCATCCCTCTCGAATAAAACGACTTGACTTAGGGATGTT
AGGTAAATAGTCCCTGTTAATCACATATTACTTTTTAACAGCGTTAATAACGCTAAAAACAAGGCCACATTTTTTGAACAGACTTTTTACCAAACAATTA
TTTATTTCAGTCAAGGTTATAAATGGGAGGTTGCGTTGCAACCACTTCACTGTCCGTCGCCCACGTTACCGCTTATCCCCAAAAAAGAAGGAGACTTGGC
ACTGGTACGAACCATTGCCTGCCATGTACGCAATCAGTCTTGAAGGCCCACTGTTTCCGCGCAAGAGTTTATACATGCCTTCTCTGTAATGCTACTAATT
TTAACACATTCTTTTCGATTCGCAGCTTTAAAGTGTCCACCATCGGACGTCTTCATCTTCTGGTGTGGGCGTTCTATGAGAAGGTAAGAATATCTAGAGA
AAATTCAAGGCCAAGTGCATCTAGTATTCACTTAGTTTGCAACCATAAGAATTTTGCATGGAGGTCCTCGTTGCACAGGTATTCCACGTTGTACTGCTAA
TTGTTTGCAATCTCTCTGTTAACAGAATGACACAGTCGTGCGCAGATGCTCCTATTGAGGCGAACTCTAAGGCTGAGAACCTCTTTAGCAACCGGTCGGA
CGAAAAAAATTTGGTGCGTGCATTGTGTATGCGGATCTCTTTTCTTCTACATAGTGGCTAGCAAATTCCTTCCGATACGGTTTTTCCATCGCATTTTGAT
GTTTTCACTCGGTTCGGTCACTACATAATGAGTGAGAACCTGCTTTATGGAGGAGCTATGGTATTAGCTGTAAAACTGCTATAAGCAGGGTGAAACGATA
TTAACTGGTAAAAATATTAAAAGCTGGTAAAAAGTGGTAGGAAGTGGTAATAACGTTAAAGCTTGGTAAAAAGCGTTGATTACTGTTAGAAAGTCACGGA
GCTTTTACCTAACATACCTAACTTGAGTGGTCGCAAAAGAACTATATTGAACAGGTACTTCTACTACTCGCTCCCTTGTTCACTCCTTTTCATGTACTCG
CCTGCGCTCTCAGGAGCTGGGACGCATCGAAACGGCGTCCGTCGCACCCCTCGACGTGATATTGGCAACGTCCAGCGGCAGCAGCGCGATGGATCCACGC
GTCGTCGTCACCGCAGTTGGGTGGACCATGATGGCGGCTCGTCCTCGCCGTCTCGTGGCAGCGAATCAATCGCTTTATTGGTCGGTAATGACCGTGATGT
AGCTGACACAAATAGGGCCAATCGCAGGAGTTGGAGTAATTGGTGTATGCCACACCAATTTGGCGACCTCACCAATGCCCTTATGTACGGGATCATTAAC
TCGATCCTGACCATTCCGTGTATGTATGGCTATGCCGCTATTATCTTTAGTCACCCAACCTTTACCACGTTTATGCCAGCGCTGTCCAAGCTCGTGATGC
TGTCCAGTGTCGTGCACCAAGTCATGTTTACACTCTTGAGCTCGCTGCCGTTTGCTATTGGCCAAGTCCAGGACGCCGGGCTCATTTTCCTCAGTGCAAT
TGCCACGTCCATTTGCAACTCGCTGGGTCCAGAGGTGTCACTGGAAGCCAAGGTCACGACTACAGTGGTTACAATTGGCTTGGCCACGGCACTGCTTGGT
GTCGTGCTCGTGCTGCTGGGGAAGTTTAAGCTTGCAGGGTTGGTGTCTTATCTACCGATGCCCGTTGTGGGCGGCTACCTGGCATATATTGGCCTCTTCT
GCTTGTATGCAGGCTTG